ID: 1044790104

View in Genome Browser
Species Human (GRCh38)
Location 8:95838461-95838483
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044790104_1044790109 17 Left 1044790104 8:95838461-95838483 CCTCCATGCCAGTCTCATTTGAC No data
Right 1044790109 8:95838501-95838523 TGTTCCCTGCTTTGTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044790104 Original CRISPR GTCAAATGAGACTGGCATGG AGG (reversed) Intergenic
No off target data available for this crispr