ID: 1044790382

View in Genome Browser
Species Human (GRCh38)
Location 8:95841082-95841104
Sequence CTGTGGCTCTTAAGGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044790382_1044790387 1 Left 1044790382 8:95841082-95841104 CCCTTCATCCTTAAGAGCCACAG No data
Right 1044790387 8:95841106-95841128 CAGTTCACGTCTCCTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044790382 Original CRISPR CTGTGGCTCTTAAGGATGAA GGG (reversed) Intergenic
No off target data available for this crispr