ID: 1044790536

View in Genome Browser
Species Human (GRCh38)
Location 8:95842425-95842447
Sequence CCATATATGGATACATGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044790530_1044790536 -4 Left 1044790530 8:95842406-95842428 CCAGGACAGTTGTCCAAATCCAT No data
Right 1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG No data
1044790528_1044790536 29 Left 1044790528 8:95842373-95842395 CCAGTCTTTATGGAAAAACAAAT No data
Right 1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044790536 Original CRISPR CCATATATGGATACATGGGA TGG Intergenic
No off target data available for this crispr