ID: 1044791887

View in Genome Browser
Species Human (GRCh38)
Location 8:95856559-95856581
Sequence TAGTGATTTAAAGATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044791887_1044791888 -1 Left 1044791887 8:95856559-95856581 CCAGCTGCATCTTTAAATCACTA No data
Right 1044791888 8:95856581-95856603 ATCAAAACAAAAACATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044791887 Original CRISPR TAGTGATTTAAAGATGCAGC TGG (reversed) Intergenic
No off target data available for this crispr