ID: 1044791888

View in Genome Browser
Species Human (GRCh38)
Location 8:95856581-95856603
Sequence ATCAAAACAAAAACATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044791887_1044791888 -1 Left 1044791887 8:95856559-95856581 CCAGCTGCATCTTTAAATCACTA No data
Right 1044791888 8:95856581-95856603 ATCAAAACAAAAACATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044791888 Original CRISPR ATCAAAACAAAAACATTTCC AGG Intergenic
No off target data available for this crispr