ID: 1044794652

View in Genome Browser
Species Human (GRCh38)
Location 8:95884788-95884810
Sequence TTCCCTGAGGACAGTAGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044794648_1044794652 -10 Left 1044794648 8:95884775-95884797 CCACCCTAGGTCATTCCCTGAGG No data
Right 1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG No data
1044794646_1044794652 9 Left 1044794646 8:95884756-95884778 CCAGATCATGGTGTACTATCCAC No data
Right 1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG No data
1044794644_1044794652 24 Left 1044794644 8:95884741-95884763 CCATTCTCATCTTTTCCAGATCA No data
Right 1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044794652 Original CRISPR TTCCCTGAGGACAGTAGTGT CGG Intergenic
No off target data available for this crispr