ID: 1044800109

View in Genome Browser
Species Human (GRCh38)
Location 8:95945266-95945288
Sequence GCCTCTCTGGTGTGCTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044800109_1044800116 11 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800116 8:95945300-95945322 CCCCCACCTGAAGCCAGGCTGGG No data
1044800109_1044800113 6 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800113 8:95945295-95945317 CGCTGCCCCCACCTGAAGCCAGG No data
1044800109_1044800123 19 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800123 8:95945308-95945330 TGAAGCCAGGCTGGGCTCTGGGG No data
1044800109_1044800125 24 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800125 8:95945313-95945335 CCAGGCTGGGCTCTGGGGCCTGG No data
1044800109_1044800121 17 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG No data
1044800109_1044800122 18 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800122 8:95945307-95945329 CTGAAGCCAGGCTGGGCTCTGGG No data
1044800109_1044800114 10 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800114 8:95945299-95945321 GCCCCCACCTGAAGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044800109 Original CRISPR GCCTCTCTGGTGTGCTTGCC AGG (reversed) Intergenic
No off target data available for this crispr