ID: 1044800121

View in Genome Browser
Species Human (GRCh38)
Location 8:95945306-95945328
Sequence CCTGAAGCCAGGCTGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044800107_1044800121 18 Left 1044800107 8:95945265-95945287 CCCTGGCAAGCACACCAGAGAGG No data
Right 1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG No data
1044800111_1044800121 4 Left 1044800111 8:95945279-95945301 CCAGAGAGGCTGGAGCCGCTGCC No data
Right 1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG No data
1044800109_1044800121 17 Left 1044800109 8:95945266-95945288 CCTGGCAAGCACACCAGAGAGGC No data
Right 1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044800121 Original CRISPR CCTGAAGCCAGGCTGGGCTC TGG Intergenic
No off target data available for this crispr