ID: 1044802409

View in Genome Browser
Species Human (GRCh38)
Location 8:95970906-95970928
Sequence AACCTGAGGCGACCCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044802404_1044802409 -9 Left 1044802404 8:95970892-95970914 CCCGCTACCAGACTAACCTGAGG No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802396_1044802409 29 Left 1044802396 8:95970854-95970876 CCTGCCCTGAAACTTTAGTCTCC No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802398_1044802409 24 Left 1044802398 8:95970859-95970881 CCTGAAACTTTAGTCTCCCACTT No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802406_1044802409 -10 Left 1044802406 8:95970893-95970915 CCGCTACCAGACTAACCTGAGGC No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802402_1044802409 7 Left 1044802402 8:95970876-95970898 CCACTTGGGTAAGCCACCCGCTA No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802401_1044802409 8 Left 1044802401 8:95970875-95970897 CCCACTTGGGTAAGCCACCCGCT No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802397_1044802409 25 Left 1044802397 8:95970858-95970880 CCCTGAAACTTTAGTCTCCCACT No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data
1044802403_1044802409 -6 Left 1044802403 8:95970889-95970911 CCACCCGCTACCAGACTAACCTG No data
Right 1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044802409 Original CRISPR AACCTGAGGCGACCCTCAAA GGG Intergenic
No off target data available for this crispr