ID: 1044807051

View in Genome Browser
Species Human (GRCh38)
Location 8:96019063-96019085
Sequence ATACACACCTTAGCAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044807051_1044807053 16 Left 1044807051 8:96019063-96019085 CCTTTTTTTGCTAAGGTGTGTAT No data
Right 1044807053 8:96019102-96019124 AACAAAAAAGTATTAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044807051 Original CRISPR ATACACACCTTAGCAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr