ID: 1044819513

View in Genome Browser
Species Human (GRCh38)
Location 8:96145944-96145966
Sequence CCTTAGATCAGGGTGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044819513_1044819519 -10 Left 1044819513 8:96145944-96145966 CCCCTGAGCACCCTGATCTAAGG No data
Right 1044819519 8:96145957-96145979 TGATCTAAGGTAGCCTCTCCAGG No data
1044819513_1044819521 3 Left 1044819513 8:96145944-96145966 CCCCTGAGCACCCTGATCTAAGG No data
Right 1044819521 8:96145970-96145992 CCTCTCCAGGTCTCTATCACAGG No data
1044819513_1044819523 8 Left 1044819513 8:96145944-96145966 CCCCTGAGCACCCTGATCTAAGG No data
Right 1044819523 8:96145975-96145997 CCAGGTCTCTATCACAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044819513 Original CRISPR CCTTAGATCAGGGTGCTCAG GGG (reversed) Intronic