ID: 1044820673

View in Genome Browser
Species Human (GRCh38)
Location 8:96153873-96153895
Sequence AGAGCCGCAATCTCTGTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044820670_1044820673 1 Left 1044820670 8:96153849-96153871 CCGTGTGCAGTCTGGGAGGAAGG 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1044820673 8:96153873-96153895 AGAGCCGCAATCTCTGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044820673 Original CRISPR AGAGCCGCAATCTCTGTCTG CGG Intronic
No off target data available for this crispr