ID: 1044824036

View in Genome Browser
Species Human (GRCh38)
Location 8:96179482-96179504
Sequence CTCTGGGAACAATGCCGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044824026_1044824036 24 Left 1044824026 8:96179435-96179457 CCGATGGCTGCATGTCGTCCCTG No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data
1044824030_1044824036 6 Left 1044824030 8:96179453-96179475 CCCTGTGGTGGGCCACTTTCAAA No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data
1044824025_1044824036 25 Left 1044824025 8:96179434-96179456 CCCGATGGCTGCATGTCGTCCCT No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data
1044824032_1044824036 -6 Left 1044824032 8:96179465-96179487 CCACTTTCAAACAGAAGCTCTGG No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data
1044824024_1044824036 26 Left 1044824024 8:96179433-96179455 CCCCGATGGCTGCATGTCGTCCC No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data
1044824031_1044824036 5 Left 1044824031 8:96179454-96179476 CCTGTGGTGGGCCACTTTCAAAC No data
Right 1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044824036 Original CRISPR CTCTGGGAACAATGCCGGAC CGG Intergenic
No off target data available for this crispr