ID: 1044824658

View in Genome Browser
Species Human (GRCh38)
Location 8:96184534-96184556
Sequence TTGGACACACACTGAGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044824658_1044824662 18 Left 1044824658 8:96184534-96184556 CCTAGAACTCAGTGTGTGTCCAA No data
Right 1044824662 8:96184575-96184597 ATTTTTCAAGTGAAAATGCAAGG No data
1044824658_1044824663 23 Left 1044824658 8:96184534-96184556 CCTAGAACTCAGTGTGTGTCCAA No data
Right 1044824663 8:96184580-96184602 TCAAGTGAAAATGCAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044824658 Original CRISPR TTGGACACACACTGAGTTCT AGG (reversed) Intergenic
No off target data available for this crispr