ID: 1044825835

View in Genome Browser
Species Human (GRCh38)
Location 8:96195943-96195965
Sequence GTGAGATTAGGTTGGGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044825826_1044825835 19 Left 1044825826 8:96195901-96195923 CCCTTGAATTATGCTGAGAGAAC No data
Right 1044825835 8:96195943-96195965 GTGAGATTAGGTTGGGTCCTAGG No data
1044825825_1044825835 20 Left 1044825825 8:96195900-96195922 CCCCTTGAATTATGCTGAGAGAA No data
Right 1044825835 8:96195943-96195965 GTGAGATTAGGTTGGGTCCTAGG No data
1044825827_1044825835 18 Left 1044825827 8:96195902-96195924 CCTTGAATTATGCTGAGAGAACC No data
Right 1044825835 8:96195943-96195965 GTGAGATTAGGTTGGGTCCTAGG No data
1044825831_1044825835 -3 Left 1044825831 8:96195923-96195945 CCTGAGGGCTAGCATGAGAGGTG No data
Right 1044825835 8:96195943-96195965 GTGAGATTAGGTTGGGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044825835 Original CRISPR GTGAGATTAGGTTGGGTCCT AGG Intergenic
No off target data available for this crispr