ID: 1044830080

View in Genome Browser
Species Human (GRCh38)
Location 8:96238663-96238685
Sequence GCTTAAGGATTTGCACATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044830080_1044830086 16 Left 1044830080 8:96238663-96238685 CCCTGATGTGCAAATCCTTAAGC No data
Right 1044830086 8:96238702-96238724 TCCTCTGGGCCAAATCACATCGG No data
1044830080_1044830085 2 Left 1044830080 8:96238663-96238685 CCCTGATGTGCAAATCCTTAAGC No data
Right 1044830085 8:96238688-96238710 CTGCTTGACAAATGTCCTCTGGG No data
1044830080_1044830084 1 Left 1044830080 8:96238663-96238685 CCCTGATGTGCAAATCCTTAAGC No data
Right 1044830084 8:96238687-96238709 TCTGCTTGACAAATGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044830080 Original CRISPR GCTTAAGGATTTGCACATCA GGG (reversed) Intergenic
No off target data available for this crispr