ID: 1044831903

View in Genome Browser
Species Human (GRCh38)
Location 8:96258890-96258912
Sequence TCAGTTACAAACCAACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044831902_1044831903 -6 Left 1044831902 8:96258873-96258895 CCAACAACAAGGCAATCTCAGTT 0: 1
1: 0
2: 2
3: 9
4: 130
Right 1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044831903 Original CRISPR TCAGTTACAAACCAACAGAC AGG Intronic
902222327 1:14974630-14974652 TCAGTAATAAAGCAACAAACTGG + Intronic
903376143 1:22867395-22867417 TCAGACACAAACACACAGACAGG - Intronic
906322229 1:44823986-44824008 TCATTTACAAAACAAGTGACAGG - Intronic
907671168 1:56476271-56476293 TCAAAAACAAACAAACAGACCGG + Intergenic
909180072 1:72412555-72412577 TCAGTCACTAAGAAACAGACTGG - Intergenic
909335936 1:74474104-74474126 TCAGTGTGAAAACAACAGACTGG + Intronic
909631972 1:77777260-77777282 TCTGTTATAAATCAATAGACTGG + Intergenic
911443233 1:97956143-97956165 TCAGTTATAAATTACCAGACAGG + Intergenic
911513169 1:98833214-98833236 TCAGTTACAAACCTCCAGGTTGG - Intergenic
911854306 1:102857436-102857458 TCATTTACAAACCAGGAGAGAGG - Intergenic
915724487 1:158007871-158007893 AGAGTGACAGACCAACAGACAGG - Intronic
921281153 1:213569312-213569334 ACATTTACAATGCAACAGACAGG - Intergenic
923032657 1:230262486-230262508 TCAGTCACACGCCAGCAGACAGG + Intronic
924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG + Intronic
1062836692 10:640476-640498 GCAGTAAGAAACCAACAGAGGGG - Intronic
1063487633 10:6434858-6434880 TCATTTTCAAACAAATAGACAGG + Intronic
1079995496 11:27291240-27291262 TCAGTTAGAACCTAACAGAGAGG - Intergenic
1081162619 11:39768443-39768465 TCACTTACTAACCAACAGTGTGG - Intergenic
1083356790 11:62072426-62072448 TCAGTTAGAAAGAAAGAGACGGG - Intergenic
1087490966 11:98826753-98826775 TCAGTTAACAACCAATAGTCAGG - Intergenic
1088295504 11:108289694-108289716 TCAGTAATAAACTAACAAACAGG - Exonic
1088568209 11:111195686-111195708 TCAGTTACATTCAAATAGACTGG - Intergenic
1089717798 11:120380443-120380465 ACTGTCACAAACCAAGAGACTGG - Intronic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1099698866 12:86059497-86059519 TCAGTTTCCAACCAGCAGAAAGG - Intronic
1103653017 12:122447914-122447936 ACAGTTGCAAAACAACATACTGG - Intergenic
1106286217 13:28320213-28320235 TCAGATACAGACGAACAGAAAGG + Intronic
1106789050 13:33136445-33136467 CAAGCTACAAACCCACAGACTGG + Intronic
1109068965 13:57738391-57738413 TCAGTTACAAAGTCACAGAAAGG + Intergenic
1111381071 13:87452838-87452860 TAAGATACAACCCAAAAGACAGG + Intergenic
1118280305 14:64422247-64422269 TCAGTTACAGACCAGCAAATGGG + Intronic
1118895475 14:69942120-69942142 TAAGTCACAAACAAACAGATAGG - Intronic
1118946492 14:70392825-70392847 TCAGTTGGAAACCACCAGAAAGG + Intronic
1120658779 14:87228251-87228273 TCAGTTCCAAACCCAAAGAAAGG - Intergenic
1121369639 14:93345267-93345289 GCTGTTACAATACAACAGACTGG - Intronic
1122563281 14:102632503-102632525 TCTATTAGAAACCAACAAACTGG - Intronic
1125296473 15:38208740-38208762 TCACTTACAAGGCAACAGAATGG - Intergenic
1127594011 15:60459827-60459849 TAAATTCCAAACCAACAGAGAGG + Intronic
1131671048 15:94619812-94619834 TCAGATACACACCAAAATACGGG - Intergenic
1132870263 16:2112656-2112678 CCAGTTACCTCCCAACAGACAGG + Intronic
1133707256 16:8366593-8366615 TCAGTTACAACACACCAGCCTGG + Intergenic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1137513582 16:49123086-49123108 GCCGTTACAAAGCATCAGACTGG + Intergenic
1139146652 16:64332743-64332765 ACAATTACACACCAACAAACTGG + Intergenic
1139951426 16:70673887-70673909 TAACTTACAATCCAGCAGACGGG + Intronic
1140807099 16:78542844-78542866 TCAGTTAAAACCCAAACGACGGG + Intronic
1148104393 17:45111724-45111746 ACAGTTACAAACCTACGGCCAGG + Exonic
1151155273 17:72120024-72120046 TCTTTTACAAACCAAGTGACCGG + Intergenic
1152395313 17:80029358-80029380 TCAGCTCCAACCCAACAGCCTGG - Intronic
1154385943 18:13892006-13892028 TCAAGTACAAACAAACACACAGG + Intronic
1156960593 18:43024909-43024931 TCATTAACAAGCCAACAGGCCGG + Intronic
1157609517 18:48947773-48947795 CCAGTGACAAAGCAGCAGACAGG + Intronic
1158397874 18:57093921-57093943 GCATTTACAAACAAACATACAGG + Intergenic
1160448981 18:78949165-78949187 TCAGCTACAAAGCAAAAGACTGG - Intergenic
1160789421 19:916832-916854 TCAGTCCCAAACCACCAGATCGG + Intergenic
1161832791 19:6621111-6621133 ACAGTTATACACCAACAGATTGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166008890 19:39926763-39926785 TCCAGAACAAACCAACAGACAGG + Intronic
1168477491 19:56687415-56687437 ACAGTCACAAACCCACACACAGG - Intergenic
925059878 2:882838-882860 TCAGATACAAACAAACAAAGGGG + Intergenic
926277224 2:11413538-11413560 TCAGTTAGAAACCTACATAAAGG + Intergenic
928176513 2:29037671-29037693 TCAGTTACAAATCAAAGGCCTGG + Intronic
934728747 2:96642698-96642720 TCTGTTGCTAAGCAACAGACAGG - Intronic
935430353 2:102969211-102969233 TCAGTTACAAACCAAAATACAGG + Intergenic
936271265 2:111050937-111050959 TCGGTTAGAAACTAACAGATTGG + Intronic
939276728 2:140007829-140007851 CAAGTTACAAAACAACAGACAGG + Intergenic
939982067 2:148794243-148794265 TCAGCTAGAAAAGAACAGACTGG + Intergenic
941613876 2:167696516-167696538 TCAGTTCCATACCATCAAACAGG + Intergenic
943127705 2:183816286-183816308 CCAGATACAAACCCACAGATAGG - Intergenic
943169578 2:184380252-184380274 ATAGTTTCAAAGCAACAGACAGG + Intergenic
945219469 2:207469077-207469099 TCAGATGGAAACCAACAGAAGGG + Intergenic
946079388 2:217104438-217104460 TCATCTAGAAACCAAAAGACTGG + Intergenic
947435856 2:230071535-230071557 TCACTGAGAGACCAACAGACAGG - Intergenic
1170977442 20:21179351-21179373 ACTATTACAAACCAACAAACTGG - Intronic
1171542739 20:25976945-25976967 TCAGCTACAAACCAAAATAGAGG - Intergenic
1174377714 20:50137522-50137544 TCAGATAGATACCAACAGAGGGG + Intronic
1174803593 20:53586095-53586117 ACAGTTACAAGCAAACAAACAGG - Intronic
1175193818 20:57228751-57228773 TCAGCCACTAACCAACAGAGTGG + Intronic
1175636884 20:60591919-60591941 TCAGTCGCCAACCAACAGGCAGG + Intergenic
1176147949 20:63573811-63573833 TAAGTTTAAAAGCAACAGACTGG + Intronic
1179058093 21:37954537-37954559 TCAGTAAAAAACCAACACAGGGG - Intronic
1179339794 21:40494959-40494981 ACAGTTATACACCAACAAACTGG + Intronic
1179789311 21:43747298-43747320 TGAGTTAAAAACCCACAGGCAGG - Intronic
1183534577 22:38390469-38390491 ACAGTTACAAGCAAACAAACAGG - Intronic
1183549497 22:38473296-38473318 ACAGACACAAACCATCAGACTGG - Intronic
1184917396 22:47579447-47579469 TCAGTTACTTACCTGCAGACGGG - Intergenic
952537770 3:34331315-34331337 ACAATTATAAACCAACAAACTGG - Intergenic
952870023 3:37890742-37890764 CCAGTTACCTGCCAACAGACAGG - Intronic
957956997 3:87200094-87200116 TCAATTAAAAACAAACAAACAGG + Intergenic
958496713 3:94853141-94853163 TCAATTTCAAACCAACAGGAGGG + Intergenic
959709631 3:109372121-109372143 GCAGCTACAAATCAAGAGACTGG + Intergenic
959935112 3:112021169-112021191 TCAGTTAGAATGCAACAGCCAGG + Intergenic
962011627 3:131397124-131397146 TCAATTAAAAACAAAAAGACAGG - Intergenic
963611445 3:147473650-147473672 TCAGTGACTAAGCAGCAGACTGG - Intronic
963697886 3:148584799-148584821 TGAGTTACCATCCAACAGTCTGG + Intergenic
966369001 3:179226456-179226478 TTGGGTAGAAACCAACAGACTGG - Intronic
968335184 3:197907577-197907599 TCACTTACACACCAAAAGAATGG - Intronic
971179308 4:24313586-24313608 TATATTACAACCCAACAGACTGG + Intergenic
973767180 4:54173331-54173353 TAGGATATAAACCAACAGACTGG + Intronic
975022869 4:69511930-69511952 ACAGTTATTAACCAACAAACTGG - Intronic
978023503 4:103843440-103843462 GCAGTTAGAAACCAACAGTCTGG + Intergenic
981981012 4:150791224-150791246 ACAGTTGCAAACCACCACACTGG + Intronic
982253093 4:153426893-153426915 TCTGTAACAAACAGACAGACAGG - Intergenic
982402153 4:154980082-154980104 ACATATACAAAACAACAGACTGG + Intergenic
987371701 5:17199506-17199528 TCAGTAACAAACAAATGGACTGG + Intronic
993542341 5:89167816-89167838 TCAGTTACAAAGCAATACAGAGG - Intergenic
999528919 5:152440085-152440107 TCAGTTTCAAACTGAGAGACAGG - Intergenic
1000152770 5:158519486-158519508 TCACTTAAAAACCACCAGTCTGG + Intergenic
1001111834 5:168903168-168903190 TCATTTAAAAAGCCACAGACTGG + Intronic
1001125464 5:169015079-169015101 TGAATTACAAACCAACTAACTGG + Intronic
1002348672 5:178566372-178566394 CCAATTACAAACCAAAAGTCAGG + Intronic
1002959292 6:1898656-1898678 TCAGTTACAAAATAAAAAACAGG + Intronic
1002976068 6:2078054-2078076 ACAGCTACACACTAACAGACTGG - Intronic
1003516596 6:6823730-6823752 TCAGTTCTTAACCACCAGACAGG + Intergenic
1004904962 6:20228836-20228858 TCAGTTAATAACCAACAGCAGGG - Intergenic
1006628246 6:35412791-35412813 CCAGTTACCAGCCAATAGACAGG - Intronic
1011897296 6:92244982-92245004 TCAGTTACAAGGCAACAGCTCGG + Intergenic
1013644830 6:112126641-112126663 TCAGTGAAAAACCATCAGAATGG + Intronic
1014574604 6:123054729-123054751 TCAGTTTCAAAACTACAGATTGG - Intronic
1017222277 6:151980127-151980149 TCACTTACCAACCAACAAAACGG - Intronic
1020523880 7:9232266-9232288 TCAGTGACTAAGCAACAGATTGG - Intergenic
1020715435 7:11668934-11668956 TCAGTTTCAAAACAGCAGACTGG + Intronic
1024269815 7:47633828-47633850 TCTGTTAAAAACAAGCAGACAGG - Intergenic
1026436390 7:70402670-70402692 ACAGTTAAGAAGCAACAGACTGG - Intronic
1030681395 7:112438058-112438080 TCATTTACTATCCCACAGACTGG - Intronic
1032273845 7:130437404-130437426 TCAGTCACAAAGCAAGAGAATGG + Intronic
1035786445 8:2264870-2264892 TCATTTAGACACCAAAAGACGGG + Intergenic
1035806362 8:2456846-2456868 TCATTTAGACACCAAAAGACGGG - Intergenic
1037459643 8:19096076-19096098 TGAGTCACAAACCCACAGAATGG + Intergenic
1041512717 8:58669525-58669547 TCAGTTAAAAACCAACAGTAGGG + Intergenic
1041572600 8:59354034-59354056 ACAGTTACACACCAACAGGTTGG - Intergenic
1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG + Intronic
1044954060 8:97461487-97461509 TATGTTACAAACCAACACACTGG + Intergenic
1047981894 8:130192116-130192138 ACAATCACACACCAACAGACTGG + Intronic
1048619131 8:136112374-136112396 TCACTTAAAAAGCAACAGAATGG + Intergenic
1052422266 9:28258614-28258636 TCTGTTAATCACCAACAGACTGG - Intronic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1057989563 9:99754210-99754232 TCACATTCAAACCAACTGACAGG + Intergenic
1058512387 9:105733635-105733657 TCAATAACAAACAAAGAGACTGG - Intronic
1186833639 X:13416272-13416294 TTATTAACAAACAAACAGACTGG + Intergenic
1187921019 X:24201973-24201995 TCAGTGAGAAAACAACAGACTGG - Intronic
1194044012 X:88979378-88979400 ACAGTTTCAGACCATCAGACTGG - Intergenic
1194828392 X:98591634-98591656 TCAGTAACAAACAAACAAAATGG - Intergenic
1195447745 X:104973043-104973065 TCAGTTACAACCTAACTGAAAGG - Intronic
1200711517 Y:6488796-6488818 TCAGAGAAAGACCAACAGACAGG + Intergenic
1201954273 Y:19605214-19605236 TCAGCTACAAAACAAAATACTGG + Intergenic