ID: 1044832286

View in Genome Browser
Species Human (GRCh38)
Location 8:96261960-96261982
Sequence CTACTGTGGCTAGTCACCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044832280_1044832286 3 Left 1044832280 8:96261934-96261956 CCCGGCTTTGCCGTCCGGCTATT 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832274_1044832286 26 Left 1044832274 8:96261911-96261933 CCCAGCCTTTGCTGGGCGCCAGA 0: 1
1: 0
2: 2
3: 8
4: 177
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832276_1044832286 21 Left 1044832276 8:96261916-96261938 CCTTTGCTGGGCGCCAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832281_1044832286 2 Left 1044832281 8:96261935-96261957 CCGGCTTTGCCGTCCGGCTATTA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832275_1044832286 25 Left 1044832275 8:96261912-96261934 CCAGCCTTTGCTGGGCGCCAGAC 0: 1
1: 0
2: 2
3: 26
4: 132
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832282_1044832286 -7 Left 1044832282 8:96261944-96261966 CCGTCCGGCTATTAGCCTACTGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
1044832278_1044832286 8 Left 1044832278 8:96261929-96261951 CCAGACCCGGCTTTGCCGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044832286 Original CRISPR CTACTGTGGCTAGTCACCCC CGG Exonic
908029054 1:59980775-59980797 CTGCTGTGGCTAAGCACTCCTGG + Intergenic
915216749 1:154345524-154345546 CTTCTGTGGCTTCTCAGCCCAGG + Exonic
1067793100 10:49302281-49302303 CTACTGTGGCTTGGCAACCCGGG - Intronic
1069810580 10:71156409-71156431 CAAGTGAGGCTAGTCACTCCAGG + Intergenic
1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG + Intronic
1085539557 11:77254046-77254068 GTGCTGTGGCTACTCACCTCTGG + Intronic
1088913097 11:114206831-114206853 CTGCTGTGGCTAGACACCTATGG + Intronic
1090596129 11:128323028-128323050 CTGCTGTGCCTAGACAACCCTGG - Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1114834343 14:26185756-26185778 CTACTGTGGTGAGTAACCTCTGG + Intergenic
1125324748 15:38525253-38525275 CTACTGTGCCCAGACACCCCAGG + Intronic
1125781691 15:42274525-42274547 CTTCTGTAGCGAGTGACCCCAGG + Intronic
1131881045 15:96862588-96862610 CTACTGTGGCTAGCAAACACAGG - Intergenic
1139489158 16:67277504-67277526 CTGCTGTGGTCAGCCACCCCTGG + Exonic
1143090758 17:4448073-4448095 ATACTGTGGCCAGTTGCCCCCGG + Intronic
1151947171 17:77326026-77326048 CTAGGTTGGCTTGTCACCCCTGG + Intronic
1153299342 18:3579495-3579517 CTACTGTGCCTGGCCACGCCTGG + Intronic
1155992156 18:32289670-32289692 CTAGTGGGTATAGTCACCCCTGG - Intronic
1164636714 19:29796781-29796803 CCACTGTGCCTGGCCACCCCAGG - Intergenic
1168097815 19:54125564-54125586 CAACTGTGGCGAGTTACCTCAGG + Intronic
924997914 2:380869-380891 CCACTGTGCCTAGGAACCCCAGG - Intergenic
926306749 2:11642831-11642853 GTAGTGTGGCTAGTCATCTCTGG + Intergenic
928028012 2:27755551-27755573 CTTCTTTGGCTTTTCACCCCAGG - Intergenic
928225744 2:29446525-29446547 TTACTGTGTCTATTGACCCCTGG + Intronic
936457461 2:112686373-112686395 CCACTGTGGCTAATGAGCCCGGG - Intergenic
946860728 2:223998098-223998120 ATACTGCGGCCACTCACCCCTGG + Exonic
1179379883 21:40888518-40888540 ATATTGTGCCTAGTCACCCGGGG - Intergenic
1185333671 22:50262282-50262304 CTCCTGTGGCCACTGACCCCGGG + Intergenic
1185344699 22:50306191-50306213 CTACTGGGGCAAGGAACCCCTGG + Intronic
950746868 3:15097712-15097734 ATACTGTGGCTTGTATCCCCAGG - Intronic
952898158 3:38092931-38092953 CTACTGTGGTCAGTGGCCCCTGG - Intronic
954752961 3:52823986-52824008 CTCCTGGGGTTAGTCTCCCCTGG + Exonic
961931394 3:130537417-130537439 CAACTGTAGCCAGTCAGCCCAGG + Intergenic
962263546 3:133929616-133929638 CTACTGTGGGTAGTGAACCTAGG - Exonic
963491170 3:146002392-146002414 CAACTGTAGCTATACACCCCAGG - Intergenic
975951098 4:79772211-79772233 CTCCTGGGTCTAGTCACCCAGGG - Intergenic
994472290 5:100222932-100222954 ATCCTGTGGCTTGTCACTCCTGG - Intergenic
1003141089 6:3471895-3471917 CTACTGTGACTAACCACCACTGG - Intergenic
1010466237 6:76169776-76169798 CTGCTCTGGCTAGTCAAACCAGG - Intergenic
1022639772 7:32170896-32170918 CCACTGGGCCTAATCACCCCAGG + Intronic
1037381380 8:18288487-18288509 CTTCTTTGCCTAGCCACCCCAGG + Intergenic
1038414055 8:27380386-27380408 CTTCTCTGGCAAGTCTCCCCTGG - Intronic
1038416946 8:27404057-27404079 GCACTGTGGATAGTCATCCCTGG - Intronic
1039573973 8:38608842-38608864 CTACTGTGCCTAGCCATCCAGGG + Intergenic
1041741256 8:61159338-61159360 CTACTTTTGCTAGTTACTCCTGG + Intronic
1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG + Exonic
1047504275 8:125466529-125466551 CTGCTCTGGCAAATCACCCCTGG - Intergenic
1049331357 8:142055784-142055806 TTACTGTGTCTTGTCACCTCGGG - Intergenic
1053207028 9:36195087-36195109 CTACAGTGGCTAGTCTGGCCAGG - Intronic
1056048524 9:82744396-82744418 CTACTGTGCCTCGTCACCTGGGG - Intergenic
1056383975 9:86080445-86080467 CCTCTGTTGCTAGACACCCCTGG - Intronic
1060588280 9:124800251-124800273 CTCCTCTGGCCAGTCACCCTTGG + Intronic
1187156401 X:16724178-16724200 CTACTGTGCCTGCTTACCCCTGG - Intronic
1188090062 X:25953160-25953182 GTGCTGTGGCCACTCACCCCTGG + Intergenic
1195166212 X:102223210-102223232 GTACTGTGGCCAGTGACCCAAGG - Intronic
1195192647 X:102463878-102463900 GTACTGTGGCCAGTGACCCAAGG + Intronic
1200654155 Y:5880218-5880240 CTACCCTGGCTATTCTCCCCAGG + Intergenic
1200654402 Y:5884363-5884385 CTACCCTGGCTATTCTCCCCAGG + Intergenic