ID: 1044839457

View in Genome Browser
Species Human (GRCh38)
Location 8:96325588-96325610
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 2, 1: 3, 2: 14, 3: 163, 4: 1075}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044839457_1044839463 -6 Left 1044839457 8:96325588-96325610 CCATCTCCTCTCCATTCCCACTG 0: 2
1: 3
2: 14
3: 163
4: 1075
Right 1044839463 8:96325605-96325627 CCACTGCCTCTGCGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044839457 Original CRISPR CAGTGGGAATGGAGAGGAGA TGG (reversed) Intronic
900187108 1:1337717-1337739 CAGTGTGAATGGGGAGGACAGGG - Intronic
900537148 1:3184522-3184544 CAGCGGGAAGGGACAGGAGGTGG - Intronic
900735818 1:4298762-4298784 GAGTGGGACTGGGGAGGGGATGG + Intergenic
901503923 1:9672018-9672040 CAGGGGGAGTGGGTAGGAGATGG + Intronic
901533528 1:9868070-9868092 GACTGGGAGTGGAGAGGGGAGGG - Intronic
901819623 1:11819297-11819319 CAGTGGGACTGGGCTGGAGAAGG + Intronic
902044351 1:13513781-13513803 CAGCAGGGATGGAGAGGGGAGGG + Exonic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
903147420 1:21383549-21383571 GAGTGGGAGTGGGGAGGAGCGGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903226774 1:21898361-21898383 GAGAGGGCAGGGAGAGGAGAAGG - Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904372157 1:30056121-30056143 CAGTGGGAATGGAATGGACGTGG - Intergenic
904558708 1:31382485-31382507 AATTGGGAAAGCAGAGGAGAAGG + Intergenic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905345729 1:37309819-37309841 CAAAGGGTAGGGAGAGGAGAGGG - Intergenic
905396257 1:37668627-37668649 CAGGGAGAAGGGAGAGGAAAGGG + Intergenic
905456323 1:38090534-38090556 CAGGGGGAAAGGAAAGGGGATGG + Intergenic
905510954 1:38519737-38519759 CAGGCTGAAGGGAGAGGAGAAGG + Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905662131 1:39735749-39735771 AGGTGGGAATGGAGAGGGGCTGG + Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906191773 1:43903573-43903595 CAGGGGGAAGAGAGAGGACAGGG + Intronic
906224027 1:44106239-44106261 AAGTGGGAGTGGAATGGAGATGG - Intergenic
906561560 1:46761755-46761777 CAGAGAGAATGCAGAGGAAAAGG + Intronic
906951908 1:50341551-50341573 AGCTGGGAATGGGGAGGAGAGGG - Intergenic
907045449 1:51297548-51297570 CAGGGGAAAGGGAGAGGACAAGG - Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907307822 1:53523335-53523357 CAGTGGGAAAGAAGATGGGAGGG - Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907385479 1:54122752-54122774 CAGAGGGTCTGCAGAGGAGAGGG - Intergenic
907401955 1:54229744-54229766 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908140159 1:61176009-61176031 GAGTGGGAATTGAGAGGCAAAGG + Intronic
908418010 1:63932291-63932313 GAGTGGGAATGGAGAGGAAGTGG + Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909578870 1:77208986-77209008 TAGTGGGAATGTAAAGGAGATGG - Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909688463 1:78377608-78377630 CAATGGGAATAAAGAGGAAAGGG - Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910341290 1:86190993-86191015 AAAAGGGAATGAAGAGGAGAAGG - Intergenic
910441804 1:87260675-87260697 GAGTAGGGATGGAGAGGAAAAGG + Intergenic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912745683 1:112243655-112243677 GAGGGAGAAAGGAGAGGAGAGGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912801994 1:112725527-112725549 CAGTGGGAATGGGGTGGGGGTGG - Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
913701712 1:121380846-121380868 TAGTAAGAATGGAGAGGAAAGGG + Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914042273 1:144061315-144061337 TAGTAAGAATGGAGAGGAAAGGG + Intergenic
914135817 1:144899173-144899195 TAGTAAGAATGGAGAGGAAAGGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
915358919 1:155273694-155273716 GAGTGGGAAAGGACAGGAGGCGG - Intronic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917165505 1:172108016-172108038 GAGTGAGAATGGAGACCAGAAGG - Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
918739153 1:188104794-188104816 CAGTGGGTAAGGGGAGGACAGGG + Intergenic
919071703 1:192763940-192763962 CAGAGGGAAGGAAGATGAGATGG - Intergenic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
919494308 1:198245179-198245201 CATTGGGTAGGCAGAGGAGAAGG + Intronic
919936104 1:202251834-202251856 CACCTGGAAGGGAGAGGAGATGG + Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920341113 1:205275709-205275731 CAGGAGGAATGGAGATGACATGG + Intergenic
920388803 1:205586144-205586166 ATATGGGAATGGAGAGGAGCCGG - Exonic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920489136 1:206399566-206399588 TAGTAAGAATGGAGAGGAAAGGG + Intronic
920742540 1:208595297-208595319 CAGTGGTAATAGGGAGGAGGAGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921559930 1:216644885-216644907 CAGTAGGAAAGGAGAAGAGCAGG - Intronic
921601010 1:217106484-217106506 CAGTGTGAATTGAGATGACAGGG + Intronic
921639743 1:217538632-217538654 CAGTCAGAATGGAGAGGCCAGGG - Intronic
921799348 1:219384010-219384032 CAGTAGGGAAGGAGAGGGGAAGG - Intergenic
921936463 1:220801174-220801196 CAGAGGGGAGTGAGAGGAGAAGG - Intronic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923167844 1:231384083-231384105 GAGTGAGAATGGAAAGGACAGGG + Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923738639 1:236635498-236635520 CTGTTGGAATGGAGAGGGTATGG + Intergenic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
924444812 1:244119356-244119378 AAGTGAGGAGGGAGAGGAGATGG + Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
1063121188 10:3106599-3106621 CAGTGGCAGGGGTGAGGAGAGGG - Intronic
1063414540 10:5862849-5862871 CAGTTGGAAGGGAGAAGGGAAGG + Intronic
1063578261 10:7281311-7281333 TAGTGGGAGTGCAGAGCAGATGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064000658 10:11661477-11661499 GAGAGAGAATGGAGAGGAGAGGG - Intergenic
1064348398 10:14554175-14554197 CAGTGGGAGGGTAGAGGAAAAGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1065492002 10:26291569-26291591 CAATTGTAATGGAGATGAGATGG - Intronic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067993670 10:51244490-51244512 CAGGGGGAATTGGGAGGAGGAGG - Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069323547 10:67203595-67203617 GAGTTGGAATGGAAAGGAGAGGG - Intronic
1069449324 10:68503001-68503023 GAGAGGGAAAGGAAAGGAGAAGG + Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069980784 10:72251006-72251028 CAGTGGGCCAGCAGAGGAGAGGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070988865 10:80713993-80714015 CAGAGGGAATAAACAGGAGAGGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071862264 10:89686314-89686336 TGGTGGGAATGGACAAGAGAGGG + Intergenic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072524493 10:96259367-96259389 CAGGGGAAATGGGAAGGAGAGGG + Intronic
1072576271 10:96703342-96703364 CAATGGGAATGGAGAGGGAGGGG + Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073103302 10:101018376-101018398 CAGAGAGAAGGGAGAGGAGAGGG + Intronic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073204534 10:101761951-101761973 CAGAGGGAATGGAAAGCAAAGGG - Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1074058883 10:109946827-109946849 GAGTGAGAGTGGAGTGGAGAAGG + Intronic
1074144074 10:110701194-110701216 CACTGGGAACGGAGTTGAGAAGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074604689 10:114949741-114949763 CAGAGGGAATGGAAAGGAAGGGG + Intronic
1074743833 10:116510831-116510853 CCGTGAGATTGGAGAAGAGAAGG + Intergenic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076694542 10:132240770-132240792 CAGGGGGGTTAGAGAGGAGAGGG + Intronic
1076731998 10:132443918-132443940 GAGTGGGGGTTGAGAGGAGAGGG - Intergenic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077225301 11:1436859-1436881 CAGTGGGAGTGGCCAAGAGAGGG + Intronic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287754 11:1775351-1775373 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287758 11:1775362-1775384 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287768 11:1775395-1775417 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287793 11:1775473-1775495 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287797 11:1775484-1775506 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287801 11:1775495-1775517 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287811 11:1775528-1775550 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287825 11:1775573-1775595 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287829 11:1775584-1775606 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287839 11:1775617-1775639 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287885 11:1775751-1775773 GAGGGGGGATGGAGAGGGGATGG + Intergenic
1077287889 11:1775762-1775784 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287893 11:1775773-1775795 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287897 11:1775784-1775806 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287910 11:1775818-1775840 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287914 11:1775829-1775851 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287926 11:1775863-1775885 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287936 11:1775896-1775918 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287940 11:1775907-1775929 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287959 11:1775963-1775985 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287963 11:1775974-1775996 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287967 11:1775985-1776007 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287977 11:1776018-1776040 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287992 11:1776063-1776085 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287996 11:1776074-1776096 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288000 11:1776085-1776107 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288010 11:1776118-1776140 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288036 11:1776197-1776219 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288051 11:1776242-1776264 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288066 11:1776287-1776309 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077725011 11:4666008-4666030 CAGTGGGATGAGAGATGAGAAGG - Intergenic
1078056750 11:8015428-8015450 CAGTGGGAATGGAAACTAAAGGG + Intergenic
1078197987 11:9152654-9152676 TACTGGGAATAGAAAGGAGATGG + Intronic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078698956 11:13662415-13662437 TAGTGAGAATGCAGAGGACAGGG - Intergenic
1078915544 11:15775180-15775202 CAGTGGAAAATGTGAGGAGATGG - Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080902516 11:36509809-36509831 CAGCGGGAAGCGAGAGGACAGGG + Intronic
1081057163 11:38424221-38424243 CATTAAGAATGAAGAGGAGAGGG - Intergenic
1081370410 11:42293692-42293714 AAGTGGGGATGGTGAGGGGAGGG + Intergenic
1081720397 11:45284910-45284932 CAGTGAGAGTGGAAAGGAAATGG - Intronic
1081746114 11:45473562-45473584 GAGAGAGAAGGGAGAGGAGATGG + Intergenic
1081782429 11:45722409-45722431 CAGGGGGAATGGGGAGGGGACGG + Intergenic
1081833076 11:46130886-46130908 CAGTGGGAATGGAGAAGCAGAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083373588 11:62201841-62201863 CTTTGGGAATAGGGAGGAGATGG + Intergenic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083726705 11:64632188-64632210 AAGTGGGAAGGGATAGGACATGG - Intronic
1084106461 11:66983993-66984015 CAGGGAGCAGGGAGAGGAGATGG - Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085065899 11:73495437-73495459 CAGTGGTGATGGAGTGGTGATGG - Intronic
1085138918 11:74121884-74121906 CAGTGGAATTGGACAGGAGGTGG - Intronic
1085201337 11:74703996-74704018 CAGTGGGGATGAAGTAGAGAAGG - Intronic
1085415829 11:76318531-76318553 TGGTGGGAACCGAGAGGAGAGGG + Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085610434 11:77943381-77943403 CAGTGGAAATGGAGAAGGGATGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086616675 11:88830008-88830030 CAGGAAGAAGGGAGAGGAGAAGG + Intronic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087199654 11:95332768-95332790 AAGTGGTCATGGAGATGAGAAGG - Intergenic
1087383791 11:97443709-97443731 CAGCGCGAATGGAGACGATAGGG - Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088273201 11:108056785-108056807 AAGTGGGAATGGAAAAGACAAGG + Intronic
1088401416 11:109424737-109424759 GGGTGGGAATGGGGAGGAAAGGG - Exonic
1088596410 11:111444246-111444268 CAGAGAGAGAGGAGAGGAGAGGG + Intronic
1088656442 11:112004427-112004449 TAGTGGGGATGGAAAGGAAAAGG + Intronic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089329096 11:117677474-117677496 CAGGGGGCAGGGAGAGGGGAGGG + Intronic
1089873926 11:121701766-121701788 CAGCGGCAATGGAGATGAAAAGG + Intergenic
1089905437 11:122033193-122033215 CATTGGGCATGTACAGGAGAGGG + Intergenic
1090026454 11:123171374-123171396 GAGTGGGACTGGAGAAGGGAGGG + Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090640980 11:128728566-128728588 CAAGGGGAATGGACAAGAGAAGG - Intronic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1091034984 11:132224739-132224761 TAGTGGGAGTGGAGAAGAGAGGG + Intronic
1091297893 11:134486607-134486629 CAGCGGTAATGGAGCGGAGCAGG - Intergenic
1091555340 12:1569295-1569317 GAGAGGGAATGGGAAGGAGAGGG - Intronic
1091998387 12:5013674-5013696 CAGCTTGATTGGAGAGGAGAAGG + Intergenic
1092938289 12:13384507-13384529 CCATGGGAATGTAAAGGAGAGGG - Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093227946 12:16507905-16507927 CAATAGGAAGGAAGAGGAGATGG + Intronic
1093340897 12:17972903-17972925 CATAAGTAATGGAGAGGAGAGGG - Intergenic
1093965483 12:25320346-25320368 CAGAAGGAATACAGAGGAGACGG + Intergenic
1094025354 12:25956087-25956109 CAGTGGCAATGAACAGGAGGAGG - Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094388995 12:29928238-29928260 TATTGGGAGGGGAGAGGAGAAGG + Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095948374 12:47766779-47766801 CAGTGGGCAGGCAGAGGAAATGG + Intronic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097188313 12:57207647-57207669 CAGTGGGAATGGTCAGCAGCTGG + Intronic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098104939 12:67059629-67059651 CAGTGGGAATGGAAACTTGAAGG + Intergenic
1098268757 12:68750068-68750090 CGGTGGGAATGGACAGGGAAAGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099016372 12:77348391-77348413 CAGAGGGAAGGGGGAGGAGGAGG + Intergenic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100270929 12:93023765-93023787 CAGTGGTGAAGGAGAAGAGAAGG - Intergenic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1100451806 12:94713731-94713753 CAGTGGGAAGTGTGTGGAGAAGG + Intergenic
1101010433 12:100443922-100443944 AAGTGGGAATGAAGTAGAGAAGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102124202 12:110467317-110467339 CAGTGAGAATGGTGAAGATATGG - Intronic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103781579 12:123402313-123402335 CAGTGGGAATGGAGATGGAGAGG + Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1104830539 12:131747815-131747837 CAGTGGGAATGTTGAGTAGGTGG + Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1106071649 13:26417692-26417714 CAGGGAGAATAGAGAGGATAGGG - Intergenic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1106977233 13:35234561-35234583 CAGTGGGAAATGAGACTAGATGG + Intronic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107739614 13:43435363-43435385 CAGTTGGAATGGAGAAGTGGAGG - Intronic
1107767849 13:43756501-43756523 GAGAGGGAAAGGAGAGGGGAGGG + Intronic
1107932072 13:45314951-45314973 AAGAAGGAAAGGAGAGGAGAGGG + Intergenic
1108140474 13:47415915-47415937 CAAAGAGAATGGACAGGAGATGG + Intergenic
1108299792 13:49061754-49061776 GAGAGGGAGAGGAGAGGAGAGGG - Intronic
1108299796 13:49061770-49061792 GAGAGGGAGAGGAGAGGAGAGGG - Intronic
1108347137 13:49557353-49557375 CAAAGGAAATGGAGAGGAAATGG + Intronic
1108489970 13:50971685-50971707 CAGTGGGCATGAAGAAGAAAGGG - Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1108878079 13:55073135-55073157 CAGAGGGAAAGGAGAGCAGGAGG + Intergenic
1109450829 13:62512480-62512502 GAGTGGACCTGGAGAGGAGAGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110412000 13:75214824-75214846 CCGTGGGGAAGGGGAGGAGAGGG - Intergenic
1111306085 13:86414719-86414741 GAGTAGGAAAGCAGAGGAGAGGG - Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1112223470 13:97514514-97514536 GCCTGGGAATGGAGCGGAGAAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112577580 13:100650023-100650045 CAGTCTTGATGGAGAGGAGATGG - Intronic
1112732327 13:102378264-102378286 TATTGGTAATGGAGAGGTGATGG + Intronic
1113452210 13:110419145-110419167 CCTGGGGAATGGAGAGGATATGG + Intronic
1113557261 13:111247923-111247945 CACAGGGAATGGAGAGGTTAGGG - Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114175687 14:20317561-20317583 CAGCGGGAAAGCAGAGGAGCTGG + Intronic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114730856 14:24991098-24991120 GAGGGGGAAGAGAGAGGAGAAGG + Intronic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115386000 14:32797619-32797641 CAGAGGGCAGTGAGAGGAGAGGG + Intronic
1115671415 14:35616623-35616645 CAGGGGGAATGGAGAATATATGG + Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1116988452 14:51246533-51246555 CATTGGGAATGGGAAGGAGGAGG + Intronic
1117026997 14:51630978-51631000 CAGAAGGAATGTAGAGGAGTGGG + Intronic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1117662311 14:58020364-58020386 CCGAGGGAACAGAGAGGAGAAGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118439548 14:65800066-65800088 CAGTGGGAATGGGCAAGACAAGG + Intergenic
1118732372 14:68677444-68677466 CAGTGGGCATCTAAAGGAGAGGG - Intronic
1118877839 14:69799383-69799405 CAGAGGGAATGGGAAGGAGTGGG - Intergenic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1119898564 14:78241266-78241288 AAGTGGGAAGGGACAGGAGGAGG - Intergenic
1119909229 14:78334702-78334724 CAGTCTGAATGAAGAGGAGAGGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120802675 14:88710055-88710077 CAGGGAGAATGGAGAGGTGAGGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121469232 14:94139010-94139032 AATGTGGAATGGAGAGGAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121756890 14:96410550-96410572 GACTGAGAATGGAGAAGAGATGG + Intronic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1121839626 14:97122374-97122396 CACTGGGAACGGAGAGGGAAGGG - Intergenic
1121849006 14:97202282-97202304 CAGTGAGAATGAAGAGGGGGCGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122930115 14:104929244-104929266 TAGTGGGGATGCGGAGGAGAGGG + Intronic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125472996 15:40022710-40022732 CAATGGAAAGGGAGAGTAGAGGG - Intronic
1125588642 15:40840343-40840365 CAGTGGGAACAGACAAGAGATGG + Intergenic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125676443 15:41504740-41504762 CAGTGGGGAAGGGGAGGGGAAGG + Intronic
1125697492 15:41651642-41651664 AAGGGGGAAGGGAGAGGAGAGGG - Intronic
1125697500 15:41651661-41651683 AAGGGGGAATGGGGAGGAGAAGG - Intronic
1125697557 15:41651816-41651838 GAGGGGGAGGGGAGAGGAGAAGG - Intronic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1125969000 15:43896968-43896990 GAATGGAAATGAAGAGGAGAAGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126710632 15:51451916-51451938 GAGTGGCAATGGAAAGGAGATGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126778435 15:52119032-52119054 GAAGGGGAATGGGGAGGAGATGG + Exonic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127597526 15:60501306-60501328 CAGTGGCAATGGTGATGTGATGG - Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128246374 15:66135470-66135492 AGGTGGGAATGGCTAGGAGAGGG + Intronic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128457051 15:67836952-67836974 CAGAGGAAATGGAGATGGGAAGG - Intergenic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128637506 15:69312619-69312641 CGGGGGGACTGGACAGGAGAAGG - Intronic
1128680444 15:69647706-69647728 CATGGGGAAGGGAGATGAGAGGG + Intergenic
1128705096 15:69832525-69832547 GAGAGGGAAAGGGGAGGAGAGGG + Intergenic
1128705102 15:69832541-69832563 GAGAGGGAAAGGGGAGGAGAGGG + Intergenic
1128705108 15:69832557-69832579 GAGAGGGAAAGGGGAGGAGAGGG + Intergenic
1129236691 15:74228004-74228026 CAGAGGTAATGGGGTGGAGATGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129792193 15:78348801-78348823 CAATAGGAATGGAGAGGGCAGGG + Intergenic
1129831833 15:78675793-78675815 GAGTGGGAATGAAGAGGTGTGGG - Intronic
1130048898 15:80467258-80467280 CAGTCGGCATGGACTGGAGAAGG + Intronic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130519070 15:84648440-84648462 GGGTGGGAATGGAGATGAGGAGG + Intronic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131260011 15:90883274-90883296 CAGGGGGATGGGAGAGGAGGGGG - Exonic
1131289052 15:91089210-91089232 GAGTGGGAATGGAAATGAGGAGG + Intergenic
1131473269 15:92714600-92714622 CCGCGGGAAGGGAGAGGAGGAGG - Intronic
1131568773 15:93510689-93510711 TAGTGAGAATGGGGTGGAGAAGG + Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133853011 16:9523914-9523936 CAATGAGAAAAGAGAGGAGAAGG - Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1134444539 16:14320842-14320864 GACTGGCAAAGGAGAGGAGAGGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135556028 16:23437319-23437341 GAGTGGGGATGGAGAGGTGGTGG - Intronic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136381505 16:29898184-29898206 CAGGGAGAAGGGAGAGGGGAGGG - Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136454380 16:30372038-30372060 GAGTGGGAATTGACAGGACATGG - Intronic
1136469001 16:30465903-30465925 CAGCGTGACTGGTGAGGAGAGGG + Intergenic
1137453913 16:48603606-48603628 AAGTGAGAAAGTAGAGGAGATGG - Intronic
1137570910 16:49565867-49565889 AGGAGAGAATGGAGAGGAGAGGG + Intronic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1138099561 16:54241689-54241711 CACTGGGAGTGGAGAAGGGATGG - Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138390556 16:56667520-56667542 CAGCATGAATGGAGAGGACATGG - Intronic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1138771264 16:59666817-59666839 AAATGGGAAAGAAGAGGAGATGG + Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140187588 16:72788546-72788568 CAGTGAGAAAGTAAAGGAGAAGG - Exonic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140723337 16:77789765-77789787 CAGGGGGAATGGGGAATAGAGGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141039204 16:80656801-80656823 CAGTGGGGTGGGAGAGGGGAGGG + Intronic
1141118233 16:81330092-81330114 CAGTGGCAATGGTGAAGAGAAGG - Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141498823 16:84429626-84429648 CAGTGGGGATGGAGAATCGATGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1203087445 16_KI270728v1_random:1191787-1191809 AAGAGGGCATGGAGAGGGGAGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142700934 17:1660325-1660347 CAGGTGGAATCGAGGGGAGAGGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1143296638 17:5876269-5876291 CACTGGGGATGGGGAGGAGGGGG + Intronic
1143773721 17:9184311-9184333 CAGGGGAAATGGCGAAGAGAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144435180 17:15233596-15233618 CAAAGGGAATGGAGATGATAAGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146517078 17:33497634-33497656 CAGGGGGAGTGAAGAGGGGAGGG + Intronic
1146561056 17:33871094-33871116 CAGGAGGAAGGGAGAGGAGGAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146943873 17:36861319-36861341 GAGTGAGAGAGGAGAGGAGAAGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147145094 17:38479923-38479945 CAGGGGGCATGGGGAGGGGAGGG + Intronic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147483853 17:40793722-40793744 CAGTGGGAATGAAAAAGAAAAGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147598519 17:41732150-41732172 GAGTGGGCAGGGACAGGAGAGGG + Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148695486 17:49555852-49555874 CAGTGGGAAGGGGGCTGAGAGGG - Intergenic
1148796991 17:50201764-50201786 GAGTTGGAATGGAGAGGGGGAGG + Intergenic
1148825977 17:50394726-50394748 CAGTGGGAAAGGAATTGAGATGG - Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149821544 17:59783744-59783766 TAGCGGGAAGGGAGAAGAGAGGG - Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150739442 17:67767601-67767623 CAAAAGGCATGGAGAGGAGAGGG - Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151778951 17:76229237-76229259 AAGTGTGAAGGAAGAGGAGAGGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152107235 17:78337769-78337791 GAGTGAGAAGGGAAAGGAGAAGG - Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152285445 17:79410053-79410075 GAGTGGCAGTGGAGAGGAGCAGG - Intronic
1152615399 17:81335667-81335689 GGGTAGGAAGGGAGAGGAGAAGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1153976506 18:10272661-10272683 GAGTGGGAACGGGGAAGAGAAGG + Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154222662 18:12470685-12470707 CAGTTGGAATAGACACGAGAGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155120755 18:22816581-22816603 CACTGGGAAAGGAGAAGGGAGGG + Intronic
1155362308 18:25015726-25015748 TAGAGGGAAGAGAGAGGAGACGG + Intergenic
1156802363 18:41131945-41131967 CAGAGAGAAGGGAGAAGAGATGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1157520123 18:48339661-48339683 GAGTGGGAATGGGAAGGAGGAGG + Intronic
1157557940 18:48624990-48625012 CAGTGGCAATGAATAGGATAGGG + Intronic
1157849628 18:51035884-51035906 GAATGGGAATGGAGTGGAGGAGG + Intronic
1157852301 18:51067041-51067063 CAGTTGGAATGTAAAGGTGAAGG + Exonic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160327714 18:77966379-77966401 GGGTGGAAAGGGAGAGGAGAGGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160932614 19:1577846-1577868 CAGCGGGCATGGGGAGGAGCTGG + Exonic
1161352584 19:3802094-3802116 CAGAGGGAAGGGACAGGGGAAGG - Intronic
1162101284 19:8340746-8340768 GAGTGGGAAGGGAGAGGTCAGGG - Intronic
1162274007 19:9638800-9638822 AAGAGGGGATGCAGAGGAGAAGG + Intronic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1164250010 19:23468037-23468059 AAGTGGAAGAGGAGAGGAGAAGG - Intergenic
1164465397 19:28483339-28483361 CAGAGGGAAGAGAAAGGAGAAGG - Intergenic
1164569854 19:29366011-29366033 CAGGGGGATTGAACAGGAGATGG - Intergenic
1164581345 19:29437230-29437252 GAATGGGAATGGAGAAGGGAAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164868774 19:31626142-31626164 AACTGGGAATAAAGAGGAGAAGG - Intergenic
1165149879 19:33754005-33754027 GAGGGGGGATGGTGAGGAGATGG - Intronic
1165354490 19:35295365-35295387 CGCTGGAAAGGGAGAGGAGAGGG - Exonic
1165378263 19:35459279-35459301 CAGTGGGCATGGAGAGGGTCTGG + Intergenic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1167269645 19:48499710-48499732 TAGGGGGAACGGTGAGGAGAGGG + Exonic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167399485 19:49255468-49255490 CAGTGTCACTGGTGAGGAGAGGG - Intergenic
1167498790 19:49834252-49834274 CATTGGGAATGCAGGGGAGGAGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168059302 19:53882423-53882445 CAGGTGGAAGGGAGAGGAGCTGG - Exonic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168296416 19:55379186-55379208 GGGTGGGAATGGAGACGAGGTGG - Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925305981 2:2848714-2848736 CAGGGAGAATGGAAAAGAGACGG + Intergenic
925337356 2:3108134-3108156 AAGTGGAAGTGGAGCGGAGAGGG - Intergenic
925641312 2:5988333-5988355 CCCTGGGAATGGAGAAGGGATGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926693212 2:15751655-15751677 CAGAGGGAATGTAGAGTAAAGGG + Intergenic
927074822 2:19567141-19567163 GAGTGGGAAGGTAGAGGTGAGGG + Intergenic
927207006 2:20617220-20617242 CAGTAGGAGTGGGGAGGGGATGG - Intronic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
928077476 2:28278358-28278380 CAGTGGGAATAGGGAGGAAGAGG + Intronic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928615285 2:33032000-33032022 CACAGGGACTTGAGAGGAGAGGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929455210 2:42060394-42060416 AACTGGGAATGGAGAAGGGATGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929832332 2:45357157-45357179 CATGGGGAAGGGAGAGTAGATGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931050436 2:58407671-58407693 CAGTGGCAATGGAGATGGGATGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931322253 2:61182502-61182524 CAGAGGGAAGGAAGAAGAGAGGG - Intronic
932107028 2:68953313-68953335 CAGAGGGAACGGATATGAGACGG + Intergenic
932418349 2:71586935-71586957 CAGTGGGAGTAGGGAGGATAGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
932738837 2:74276130-74276152 AAGAGAGAAAGGAGAGGAGAAGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933274295 2:80267174-80267196 AAGTGAGAATGAAGAGGAGAGGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933870865 2:86563937-86563959 CAGTTGGGATGGAAAGGGGAGGG - Intronic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934105008 2:88687542-88687564 GAGTGAGAAAGGAGAGGAAATGG + Intergenic
934663327 2:96154522-96154544 CAGTGGGTACGTAGAGGAAAAGG - Intergenic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935856384 2:107279131-107279153 CAGTGGGAAAGGAGAAGTCAGGG - Intergenic
936258579 2:110937502-110937524 GATTGGGAGTGGAGAGGAGAAGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
937905337 2:127050228-127050250 CCAAGGGAAGGGAGAGGAGAGGG + Intronic
937957071 2:127427493-127427515 GAGTGGGAGTGGAGAGGTGAAGG - Intronic
937981745 2:127619867-127619889 GAGTAGGAATGGTCAGGAGATGG + Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938076228 2:128340038-128340060 GGGAGGGAAGGGAGAGGAGAGGG + Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938258200 2:129876968-129876990 AAGAGGGAAGGCAGAGGAGAAGG - Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938970692 2:136428543-136428565 GAGTGGAATTGGAGAGGAAAAGG + Intergenic
939035020 2:137120502-137120524 CAGAGAGAAGGGAGAGGGGATGG + Intronic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941099983 2:161284801-161284823 CAGTGGGAGTGGAAAGGATTAGG - Intergenic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
942189585 2:173456836-173456858 CGGTGGGAACGGAGAAGAGCAGG + Intergenic
942321174 2:174737203-174737225 CCATGGGAATGACGAGGAGAAGG + Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944101603 2:196033439-196033461 CAGGGGGAATGGGGAGATGATGG - Intronic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945273010 2:207960642-207960664 TAATGGGAGTGGAGAGGAAAGGG + Intronic
946043521 2:216802810-216802832 GAGTGGGGAAGGAGAGGAGGAGG + Intergenic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946516736 2:220420032-220420054 CATGGGGAAGGGAGAGCAGAGGG + Intergenic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
946736827 2:222762122-222762144 CAATGGGAATGGGGAGGGGAGGG + Intergenic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
948192199 2:236068380-236068402 CAGTGCCAGAGGAGAGGAGAGGG - Intronic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
948424161 2:237877225-237877247 CAGTGGTCATGAAGAGGTGATGG - Exonic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948855248 2:240727305-240727327 CACAGGGAAGGGAGAGGGGAGGG + Intronic
948871924 2:240805043-240805065 AAGTGGGGAGGGAGAGGGGAGGG + Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169361812 20:4956777-4956799 AAGAGGGAAGGGAGAGGGGAGGG - Intronic
1169487994 20:6049451-6049473 CAGTGGCAATGGTGATGTGATGG - Intronic
1169957768 20:11124656-11124678 CAGTCAGGATGGAGAGGGGATGG + Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170793548 20:19527195-19527217 AAGTGGGAATTTAGAGTAGAGGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171015042 20:21532887-21532909 CACTGGGAATGGACAAGAGCAGG + Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1172501867 20:35433434-35433456 GAGTGGGAGAGAAGAGGAGAGGG - Exonic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173427388 20:42954935-42954957 GAGGGAGAAGGGAGAGGAGAAGG + Intronic
1173633720 20:44536445-44536467 CAGCGGAAAGGGAAAGGAGAGGG + Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174061588 20:47836750-47836772 CAGTGAGATAGGAGAGGAGCAGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174892294 20:54408971-54408993 CATTGGGGATGGAGATGGGAAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175345263 20:58268521-58268543 GGGTGGGAATGAAGAGGAGCGGG + Intergenic
1175890585 20:62314164-62314186 GAGTGGGCACGGAGAGGCGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176125448 20:63472790-63472812 GAGGGGGGAAGGAGAGGAGAGGG + Intergenic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176979224 21:15360239-15360261 GAGAGGGAATGCAGAAGAGACGG - Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1178664299 21:34533309-34533331 GAGTGAGAATGGAGTGGACAGGG - Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179249883 21:39663929-39663951 GAGTGGGAATGGAGAGGTCCAGG + Exonic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179595024 21:42437642-42437664 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1179992960 21:44958201-44958223 CAGTGGCTATGGGGAGGGGAAGG - Intronic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181149857 22:20875477-20875499 CAGTGGGGACCCAGAGGAGAGGG + Intronic
1181200142 22:21212569-21212591 CAGTGGGAAGGGATATGACAGGG + Intronic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181887800 22:26035454-26035476 CAGTGGTGATGCAGAAGAGAAGG + Intergenic
1181961108 22:26622419-26622441 CAGATGGAAAGGACAGGAGAGGG + Intronic
1181990691 22:26834598-26834620 CAGAGTGAGTGAAGAGGAGATGG - Intergenic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182146208 22:27998442-27998464 CAGTGGGGTTGGGGAGGGGAGGG - Intronic
1182767492 22:32768815-32768837 CACTGAGAATCTAGAGGAGAAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183514666 22:38257908-38257930 CAGAGAGATTGCAGAGGAGAGGG - Intronic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1183987861 22:41579153-41579175 GAGTAGGAAGGGCGAGGAGACGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184212580 22:43044632-43044654 GAGTGGGCGTGGAGAAGAGAGGG - Intronic
1184408523 22:44313525-44313547 CAGTAGGAATGGGGTGGGGATGG + Intergenic
1184569159 22:45310961-45310983 CACTGGAAATAGAGATGAGACGG + Intronic
1184792509 22:46708750-46708772 CAGAGGGAAGGCAGAGGACAGGG + Intronic
1184800295 22:46754892-46754914 CAGTGGGGGTGGGGAGGGGATGG - Intergenic
949247585 3:1943175-1943197 CAGGGGGAAGGGAGAGTACAAGG + Intergenic
949284380 3:2383762-2383784 GAGAGGGAAGGGAGAGGAGAGGG - Intronic
949735033 3:7161921-7161943 CAGGGCGAATGGAGCTGAGATGG + Intronic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950041728 3:9924033-9924055 CAGTGGGAATGGACTTGGGAAGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950531221 3:13553306-13553328 GAGTGGGCCTGGAGAGGACAAGG + Intronic
950773999 3:15334104-15334126 CATTTAGAATGGAGAGGATAGGG - Intronic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952052000 3:29395183-29395205 GACTAGCAATGGAGAGGAGAGGG - Intronic
952298630 3:32084544-32084566 AACTGGAAATGGAGAAGAGAGGG + Intergenic
953138850 3:40208877-40208899 GGGTGGGAATGGAGAGGAAGAGG - Intronic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953403149 3:42644538-42644560 CAGTTGCAATGGACAGGGGAAGG - Intronic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
954194587 3:48989193-48989215 TATGGGGAAGGGAGAGGAGATGG + Intergenic
954215945 3:49124549-49124571 CAGTGGCACTGGTCAGGAGATGG + Exonic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954530051 3:51310435-51310457 CCATGGGAACAGAGAGGAGAGGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955018294 3:55092855-55092877 GATTGGGAGTGGAGAGGAGGAGG - Intergenic
955141855 3:56277582-56277604 CAGTGGGAATAGACAGGGAAAGG - Intronic
955353341 3:58210030-58210052 GAGTGGGGAAGTAGAGGAGAGGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956440942 3:69279799-69279821 AAGTGGGAAGGAAGAGGAGGAGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957360117 3:79144457-79144479 AAGAAGGAAAGGAGAGGAGAAGG - Intronic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958058890 3:88451664-88451686 CAGTTGGAAGGAAGAAGAGAAGG - Intergenic
958121073 3:89289282-89289304 CAGTGGGAATAAAGAGTAAAAGG - Intronic
959049285 3:101509138-101509160 GAGTGGGAAAGGGGTGGAGAGGG - Intronic
959136900 3:102434565-102434587 TGATGGGAATGGGGAGGAGAAGG - Intronic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959388903 3:105748502-105748524 CAGTGGGGATATAGAGGAAAAGG + Intronic
959391763 3:105783667-105783689 CAGTGGGAATAAAGCTGAGATGG + Intronic
959538308 3:107512257-107512279 AAGTGTGAATGGAGAAGAGCTGG - Intergenic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
959897785 3:111624658-111624680 CAGTGGGAATCGAGAGTGAAGGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
960715415 3:120570017-120570039 AAGTAGGAATGGAGAAGAGGGGG + Intergenic
960806689 3:121590487-121590509 CAGAAGGAAGGGAGAGGAGGAGG - Intergenic
961094380 3:124142061-124142083 AATTGAGAATGGAGGGGAGAGGG - Intronic
961173561 3:124816108-124816130 CAGTGGGAAGGGGGAAGAAAGGG + Intronic
961202270 3:125054965-125054987 CATTGGGAAAGGAAAGGGGAGGG + Intronic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962077211 3:132095129-132095151 AAGGGGGAAAGGAGAGGTGATGG + Intronic
962089704 3:132230381-132230403 CACTGGAACTGGGGAGGAGAGGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962311144 3:134327619-134327641 CAGTGGGAAGGAAGAGGAAGAGG + Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963249517 3:143090274-143090296 AAGAGGGAAGGGAGAGGGGAAGG - Intergenic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964368397 3:155973179-155973201 GAGAGGGGATAGAGAGGAGAGGG - Intergenic
964791882 3:160460456-160460478 CAGCAGGAATGGAGAGGTGGGGG + Intronic
965550592 3:169961250-169961272 CAGTGGGAAAGGACATGAGGAGG + Intergenic
965610123 3:170535060-170535082 CCATGGAAAAGGAGAGGAGAAGG - Intronic
965888562 3:173479707-173479729 CACAGGAAATGGAGATGAGATGG + Intronic
966031265 3:175350645-175350667 AAATGGGAAAGGAGAGGAGTGGG + Intronic
966415677 3:179687314-179687336 CAGCAGGAATGGAGAAGACAGGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
966462789 3:180196234-180196256 GAGGGTGATTGGAGAGGAGAGGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966747362 3:183290327-183290349 AATTGGGACTTGAGAGGAGAAGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966989277 3:185212429-185212451 GAGTGGGAAGGGAGTGTAGAAGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967460093 3:189735605-189735627 CAATGGGAATGGAGATGATAGGG - Intronic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
967880207 3:194296616-194296638 CAGGGGGAGGGGAGAGTAGAAGG + Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968062403 3:195735605-195735627 AAGTGGATATGTAGAGGAGAAGG - Intronic
968282970 3:197490787-197490809 AAGTGGGATGGGAGTGGAGAGGG + Intergenic
968558311 4:1261621-1261643 CAGTGGGTAAGGCAAGGAGAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969126524 4:4952453-4952475 GAGAGGGAATGAGGAGGAGATGG - Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969348212 4:6582219-6582241 CAGTGGGAAGGGAGTGGGGTTGG - Intronic
970123411 4:12782819-12782841 AGGTGGAAATGGTGAGGAGAGGG - Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
970780783 4:19734978-19735000 CATCGGGACTGGAGAGGAAAAGG + Intergenic
970922911 4:21415869-21415891 CAGAGTGAATGAAGAGGAGATGG + Intronic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971044036 4:22784888-22784910 CAGTGGCAATGAAGAAGAGGAGG - Intergenic
971162788 4:24150912-24150934 GCGTGGAAATAGAGAGGAGAGGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972927818 4:44033642-44033664 GAGTGTGAATGAAGAAGAGAAGG + Intergenic
973181865 4:47278678-47278700 CAGTGAGAATGGAGCAGAAATGG - Intronic
973184302 4:47306429-47306451 TAGGAGGAAGGGAGAGGAGAAGG + Intronic
973302810 4:48607616-48607638 GAGTGGGAGTGGGGAAGAGAAGG - Intronic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975485577 4:74931682-74931704 CAGGGAGGATGGAGAGGGGATGG + Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
977963695 4:103117459-103117481 CAGGGATAATGGAGAAGAGAGGG - Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978443592 4:108759710-108759732 TAGTGGGAATGGGGAGGGGTGGG + Intronic
980124353 4:128759636-128759658 CAGAGGGAAGCCAGAGGAGAAGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980768328 4:137337401-137337423 CAGTGAAAATGTAAAGGAGAAGG - Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981910002 4:149968004-149968026 GATGGGGAATTGAGAGGAGAAGG - Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982219536 4:153112707-153112729 CAGAGGAAATGTGGAGGAGAAGG - Intergenic
982255459 4:153447118-153447140 AAGTGGAAAGGGGGAGGAGAGGG - Intergenic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
983003927 4:162458588-162458610 AAAGGGGAATGGAGAGGTGAAGG - Intergenic
983076325 4:163331710-163331732 GATTGGGAATGGACAGGAGGTGG - Intronic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984703158 4:182831842-182831864 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703325 4:182832327-182832349 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703329 4:182832343-182832365 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703340 4:182832375-182832397 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703344 4:182832391-182832413 CAGAAGGAGGGGAGAGGAGAAGG - Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985140975 4:186840512-186840534 GAGAGGGAGTGGGGAGGAGAAGG - Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985709410 5:1419915-1419937 AAGTGGGAAGGAAGGGGAGAAGG - Intronic
986494659 5:8330455-8330477 CAATGGCAAGGAAGAGGAGATGG - Intergenic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
986883944 5:12211219-12211241 TAGGGGGAAGGGAGAGGATAGGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988342430 5:29990537-29990559 CAGAAGGAATGGAGAATAGAAGG + Intergenic
988621658 5:32829635-32829657 CATTTAGACTGGAGAGGAGAAGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990326273 5:54678664-54678686 CAGTGGGAATGAGGATGGGAGGG + Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990957581 5:61359153-61359175 CAGTGGGAGTGGATCAGAGAGGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992019281 5:72606375-72606397 AAGTGGGAATGAAGAGTGGATGG - Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992579097 5:78152095-78152117 GAGAGGGAAGGGAAAGGAGAGGG - Intronic
992880680 5:81106286-81106308 CTGTGAGAATGAAGAGGAAAGGG - Intronic
993129987 5:83884244-83884266 AAGTGGCAAGGCAGAGGAGAAGG - Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993688141 5:90966228-90966250 CAGTGGGAACTTTGAGGAGAGGG + Intronic
994241657 5:97429461-97429483 CAGGGTGAATGGAGAAGAGAGGG + Intergenic
994714717 5:103307415-103307437 CAGTGGGAGGACAGAGGAGAAGG - Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995565617 5:113430922-113430944 CATGGAGAATGGAAAGGAGAGGG + Intronic
996022025 5:118601890-118601912 CAAGGGGAATTGAGAGGAAATGG - Intergenic
996053778 5:118962638-118962660 AAGAGGGAATGAAAAGGAGAAGG + Intronic
996108294 5:119533417-119533439 TAGTAATAATGGAGAGGAGAGGG + Intronic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
997506602 5:134422766-134422788 TGGGGGGAAGGGAGAGGAGAAGG - Intergenic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998383535 5:141742705-141742727 CAGTGGGAAGTGGGAGGGGAGGG + Intergenic
998720960 5:144948574-144948596 AAGTGGGAATATTGAGGAGATGG - Intergenic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999445884 5:151639077-151639099 CAGTTGGAATGAGGAGGAGAAGG - Intergenic
999596771 5:153214143-153214165 AAGTGTGAATAGAGAGGAAAAGG + Intergenic
999729052 5:154462070-154462092 GAGTGGAATGGGAGAGGAGAAGG - Intergenic
999889374 5:155960152-155960174 AGGTGGAAATGAAGAGGAGAAGG - Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000181067 5:158811898-158811920 CAATGAGAATGAACAGGAGAGGG - Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001597420 5:172907105-172907127 GGATGGGAATGGAGAGGAGGAGG - Intronic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312991 5:178325838-178325860 CACTGGGAATGGAGAGCATGTGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003311160 6:4971012-4971034 CAGAGGGAAAGGGGAGGACAAGG + Intergenic
1003390932 6:5712190-5712212 TAGTGAGGATGGAAAGGAGAAGG - Intronic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1004055673 6:12135952-12135974 CAGTGGGAATGGAAAGGGTATGG - Intronic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1006376929 6:33676881-33676903 CAGTGGCAAGGGTGAGGAGGTGG + Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1007219651 6:40268494-40268516 CAGTGTGAAAGGAGAGGGCAGGG + Intergenic
1007296068 6:40821531-40821553 AAGAGGGAATGGAAAGGCGAGGG + Intergenic
1007499737 6:42287677-42287699 GAGTGGGAATGGGGAGGTGGTGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1007734653 6:43972987-43973009 CAGTGGAAATGGAAAGGGAAAGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008202859 6:48614068-48614090 CTGAGGGAATGGAGAGGTTATGG - Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009593707 6:65708688-65708710 CAGAGGGCAAGGAGAGGAGGGGG - Intergenic
1009760664 6:68001332-68001354 CAGTGGGAGTGAGGAGGAGGTGG - Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010318337 6:74476297-74476319 CACTGGGAATACAGAGGTGATGG + Intergenic
1010350767 6:74871666-74871688 CAGTGGTCATGGAAATGAGAAGG + Intergenic
1010804069 6:80214108-80214130 TAGTGGGAATGGAGACGATCAGG + Intronic
1011104867 6:83768423-83768445 CCATCGGAATGGAGAAGAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012473105 6:99592030-99592052 CATTGGGAATTGAAATGAGAGGG - Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013341133 6:109217200-109217222 CAGGGAGAATAGAGAAGAGAAGG - Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1014287362 6:119515274-119515296 CAGGGAGAATGAAGAGGAGATGG + Intergenic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1014703251 6:124715403-124715425 CACAGGGAGGGGAGAGGAGAAGG - Intronic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015146916 6:129997296-129997318 CACTGGGGATGGAGAGGCCAAGG + Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1015886447 6:137923201-137923223 CAATGGGAACAGAGAGGAAAAGG - Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016183313 6:141173080-141173102 AAGAAGGAATGGGGAGGAGACGG + Intergenic
1016426606 6:143942114-143942136 CAGTTGGAATGAAGGCGAGATGG + Exonic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018372135 6:163178066-163178088 AAGTTGGAACGGAGAGCAGACGG + Intronic
1018456820 6:163960799-163960821 GAGTGGGAAAGGAGATGACAGGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018839583 6:167508232-167508254 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1018839710 6:167508574-167508596 GAGAGGGAATGGGGAGGAGAAGG - Intergenic
1018839767 6:167508722-167508744 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1019159087 6:170057636-170057658 GAGAGGGAATGGGGAGGGGAGGG - Intergenic
1019624681 7:2009946-2009968 CAGTGGGAATCGCGAGGTGCTGG - Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019773971 7:2901451-2901473 CAGATGGAGAGGAGAGGAGAGGG + Intergenic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020356305 7:7279450-7279472 TGGTGGGAATGGAGTGGAGGAGG + Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021418583 7:20419144-20419166 CATTTGTAATGGAGAGGAGAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022021611 7:26404949-26404971 CAGGGAGAAAGGAGAGCAGAAGG + Intergenic
1022052567 7:26692113-26692135 CAAAGGAAATGGAAAGGAGATGG + Intronic
1022255224 7:28649455-28649477 CAGTTGCAATGGAGAACAGATGG + Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022548261 7:31209442-31209464 CAGTGGGAATGGAGAGGCTGCGG + Intergenic
1022786801 7:33646127-33646149 CAGTGATGATGGAAAGGAGAAGG - Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023157509 7:37265770-37265792 CATGGGGAAAGTAGAGGAGAGGG - Intronic
1023227653 7:37987905-37987927 CAGTGGGAAGGGAAATGAAATGG - Intronic
1023236515 7:38095795-38095817 AAGAGGGCAAGGAGAGGAGATGG + Intergenic
1023280328 7:38562663-38562685 AAGAGGGGAGGGAGAGGAGAGGG + Intronic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024985481 7:55190129-55190151 GGGTGGAAAGGGAGAGGAGAGGG - Intronic
1025842668 7:65165654-65165676 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1025880377 7:65530314-65530336 CAGTGGAAATGGAGAAGGGATGG + Intergenic
1025893060 7:65672290-65672312 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026391416 7:69906381-69906403 GAGTGGGAAGTGGGAGGAGATGG + Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026880590 7:73904620-73904642 CAGTGGGGATGGAGAGGGCCGGG + Intergenic
1026903270 7:74048596-74048618 TAATGGGAATGGAGAGGCTAGGG - Intronic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027195347 7:76026257-76026279 CAGCGGGAATGGGGAGGAAAGGG + Intronic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027968914 7:85051466-85051488 CAGAGGCAATTGAGAGGAAATGG - Intronic
1028475097 7:91244633-91244655 CAGAGAGAATGCTGAGGAGAAGG - Intergenic
1028527027 7:91797881-91797903 CAGCTGGAATGCAGAGGACATGG + Intronic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1029424117 7:100485975-100485997 CAATGGGAGAGAAGAGGAGAAGG - Intronic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1030654168 7:112147995-112148017 CAGTGGGAGTGTGGAGGAGAGGG - Intronic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031564338 7:123276822-123276844 CATTAGGAAGGGAGAGGATAAGG - Intergenic
1031589577 7:123573259-123573281 CAGAGGGAAAGGAGAGGTTATGG - Intronic
1031678300 7:124638366-124638388 AAATGGGAATGAAGAGCAGAAGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1033249397 7:139745790-139745812 CAGTGAGCATGCAGAGGAGGAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1033901022 7:146140332-146140354 CAGTGTGCATGAATAGGAGATGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036066115 8:5383379-5383401 CAGTGGGAAAGGAGACGACAAGG + Intergenic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1037162801 8:15793348-15793370 CAGGGGAAAAGGAGTGGAGAAGG - Intergenic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037569918 8:20149407-20149429 AAGTGGGAAAGGAGAGGAAGAGG - Intronic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038104121 8:24414273-24414295 CAGTGAGAAATCAGAGGAGAGGG + Intergenic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1038860905 8:31388011-31388033 GAGGGGGAGGGGAGAGGAGAGGG - Intergenic
1038860913 8:31388029-31388051 GAGAGGGAGGGGAGAGGAGAGGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039212917 8:35236211-35236233 GAGAGGAAGTGGAGAGGAGAGGG - Intronic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039573662 8:38606278-38606300 CATTGGGCATGGGCAGGAGAGGG - Intergenic
1039669945 8:39584628-39584650 CAGTGAGGAGGGCGAGGAGAAGG - Exonic
1039724565 8:40202050-40202072 CAGTTTGAATGGTGAGGACAGGG + Intergenic
1039792956 8:40890486-40890508 CAGTGGCAATGGGGAGGGGGAGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1041108639 8:54466025-54466047 CACTGGGAAAGGTGAGGACATGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043420275 8:80090439-80090461 CAGTGGGGATGGGGAGGGGCGGG + Intronic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044693565 8:94901318-94901340 CAGGGAGACTGGATAGGAGATGG + Intronic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044848783 8:96407831-96407853 CAGTGGTAATGAAGAGATGATGG + Intergenic
1044901554 8:96951176-96951198 CATGGGGAATGGAGAAGAAAAGG - Intronic
1044906920 8:97014195-97014217 CAGTAGGAATGTAAAGGAGGGGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045605263 8:103766834-103766856 TAATGGGAATGAAGAAGAGATGG + Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047090177 8:121565911-121565933 GAAAGGGAATGGAGAGGAAATGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047406091 8:124586852-124586874 CAGTGGGAATGGGAAGGAGGGGG + Intronic
1047416264 8:124667076-124667098 CAGGTGGAGGGGAGAGGAGATGG + Intronic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1049014103 8:139907505-139907527 TGGGGGGAAGGGAGAGGAGAGGG + Intronic
1049022432 8:139966632-139966654 CAGTGGGATTAGAAAGGAGCTGG - Intronic
1049069979 8:140349033-140349055 CCTTGGCAAGGGAGAGGAGAGGG + Intronic
1049240492 8:141535319-141535341 CAGAGGGACTGGGGAGGAGGGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049688789 8:143949859-143949881 CACTGGGACAGGAGAGGAGGCGG + Intronic
1049698756 8:143996979-143997001 CAGCGGGAAGGGGGAGGGGAGGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050459978 9:5869406-5869428 CCTTGGGAATGAGGAGGAGAAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051812828 9:21069617-21069639 CAGTTGGGATGGGCAGGAGAGGG - Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1052951886 9:34219886-34219908 AGGTGGGAAGGGAGAGGGGAGGG - Intronic
1053329338 9:37188876-37188898 GAGGGGGAGGGGAGAGGAGAAGG - Intronic
1053420471 9:37974449-37974471 CAGAGGAAAGGGAGAGGTGAGGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054800649 9:69345104-69345126 CAGTGGGCATGCAAAGTAGATGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055558599 9:77500594-77500616 CAGTGGGGATGGGGATGGGAGGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057275329 9:93673314-93673336 AGATGGGCATGGAGAGGAGACGG - Intronic
1057448663 9:95137369-95137391 CAGGGGGAAGGGAGAAGGGAGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1058553236 9:106138191-106138213 CATTGAGAAAGCAGAGGAGAAGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059508871 9:114825435-114825457 CAGGGGGCTTGAAGAGGAGAGGG - Intergenic
1060001915 9:119966590-119966612 CAGTGGAAAGGTAGAGGACATGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060267333 9:122120055-122120077 CAGGGACAAGGGAGAGGAGAGGG - Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060797188 9:126520673-126520695 CAGCTGGCATGGAAAGGAGATGG + Intergenic
1061274593 9:129562121-129562143 CAGTGGGAAGGCAGGGGTGAGGG + Intergenic
1061378567 9:130240616-130240638 CAGTGGGCATGGAAAGGGGCTGG + Intergenic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1061750459 9:132773382-132773404 CAGCTGGAAGGGAGAGGACAGGG - Intronic
1061824391 9:133248758-133248780 CACCGGGACTGGAGAGGAGTGGG + Intergenic
1062518906 9:136949593-136949615 GAGTGGGAAGAGAGAGGGGAGGG + Intronic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185511623 X:668222-668244 GAGGGGGAAAGGGGAGGAGAGGG - Intergenic
1185973398 X:4690672-4690694 CAGTGAGAGTGAAGAGGAAATGG + Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186796947 X:13056284-13056306 CAGTGGGAATGGCCAGGTTAGGG - Intergenic
1186997377 X:15138364-15138386 CACTGGTAGGGGAGAGGAGAAGG + Intergenic
1187274245 X:17804569-17804591 CAGTAGGACTGGTGAGGACAAGG + Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187421106 X:19134496-19134518 CAGGGGGAAGGGAGAGGAAGAGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189988879 X:46576197-46576219 AAGGGGGAAGGGAGAGGAGGAGG - Intronic
1190004291 X:46720311-46720333 GAGTGGGAAAGGACAGGATATGG - Intronic
1190179749 X:48182180-48182202 CATGGGGAGAGGAGAGGAGAGGG - Intergenic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190192761 X:48291393-48291415 CATGGGGAGAGGAGAGGAGAGGG - Intergenic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190248199 X:48704684-48704706 GAGGGGGAATGGAGAAGAGACGG - Intronic
1190259465 X:48788903-48788925 CAGAGAGATAGGAGAGGAGAGGG + Intronic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1190869884 X:54415826-54415848 GAGTGGGAATGAGGAGGACATGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191672756 X:63764271-63764293 CAGTCAGAATGGCGATGAGATGG - Intronic
1192036717 X:67570963-67570985 CACAGGAAATGGAGAGGTGAAGG + Intronic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193703984 X:84798060-84798082 CAAAGGGAAAGGAGAGGGGAAGG - Intergenic
1194545825 X:95232254-95232276 CAGAGGGAATGAGGAGGAGCAGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1194680027 X:96841425-96841447 GGAAGGGAATGGAGAGGAGAAGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196237527 X:113299940-113299962 GAGGGGGAGGGGAGAGGAGAGGG - Intergenic
1196265745 X:113644144-113644166 CAGTGGGAATAGAGAGGTATAGG - Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1197607755 X:128605383-128605405 TAGTGGGAATTGAAAGGAGAAGG - Intergenic
1197627305 X:128816530-128816552 CAGTGGGAATAAAAAGGACAAGG + Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198146699 X:133864504-133864526 CAGGTGGAAAGGAGAGGTGATGG - Intronic
1198683453 X:139204788-139204810 CGCGGGGAATGGGGAGGAGAGGG + Intronic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199404630 X:147442668-147442690 CAGTGGGGAAGGTTAGGAGAGGG + Intergenic
1199598803 X:149528418-149528440 GAATGGGAAAGGAGAGGAGAGGG - Intronic
1199598822 X:149528507-149528529 GAAGGGGAAAGGAGAGGAGAGGG - Intronic
1199598872 X:149528715-149528737 GAAGGGGAAAGGAGAGGAGAGGG - Intronic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199792316 X:151166915-151166937 CACTGGGAGTGGACACGAGAGGG + Intergenic
1200108885 X:153728994-153729016 GAGAGGGAGTGGAGAGGGGACGG + Intronic
1200306698 X:155032702-155032724 CAGTGATAATGAAGATGAGAGGG - Intronic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic