ID: 1044839984

View in Genome Browser
Species Human (GRCh38)
Location 8:96329240-96329262
Sequence CCATTCACATCAAGCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044839984_1044839988 -1 Left 1044839984 8:96329240-96329262 CCAGGATGGCTTGATGTGAATGG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1044839988 8:96329262-96329284 GGTTTCTAGAGTGAGGAATTTGG No data
1044839984_1044839989 3 Left 1044839984 8:96329240-96329262 CCAGGATGGCTTGATGTGAATGG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1044839989 8:96329266-96329288 TCTAGAGTGAGGAATTTGGAAGG No data
1044839984_1044839990 9 Left 1044839984 8:96329240-96329262 CCAGGATGGCTTGATGTGAATGG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1044839990 8:96329272-96329294 GTGAGGAATTTGGAAGGAGCTGG No data
1044839984_1044839987 -8 Left 1044839984 8:96329240-96329262 CCAGGATGGCTTGATGTGAATGG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1044839987 8:96329255-96329277 GTGAATGGGTTTCTAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044839984 Original CRISPR CCATTCACATCAAGCCATCC TGG (reversed) Intronic
902220773 1:14963302-14963324 CCATTCACCTCAATCCTGCCAGG + Intronic
903169250 1:21541898-21541920 CCATTGACAGCACCCCATCCTGG - Intronic
904210575 1:28884512-28884534 CCACTCACATTTAGCGATCCTGG - Intergenic
908752680 1:67439628-67439650 CCATGTACCTCAAGCCATACAGG + Intergenic
910839350 1:91546630-91546652 CCAGTCAGTTCAAGCCAGCCTGG + Intergenic
911700402 1:100945829-100945851 CCATTCCCATCAAGCTACCAAGG - Intronic
920091409 1:203455636-203455658 CCATTCACATCAACACATAAGGG - Intergenic
922185371 1:223269907-223269929 CCACTCACATCAGGGCTTCCAGG - Intronic
1063948743 10:11203026-11203048 CCATCCTCATCCAGTCATCCAGG + Intronic
1067553382 10:47251000-47251022 CTCTTCAACTCAAGCCATCCTGG - Intergenic
1067903012 10:50262062-50262084 GCATTCACACCCAGCCATGCTGG - Intergenic
1068256640 10:54519661-54519683 CCATCCCCATCAAGCTATCAAGG + Intronic
1068465932 10:57391510-57391532 CCATGCACATAGAGCCTTCCTGG + Intergenic
1068679839 10:59807815-59807837 CCAGACACAGCAAGCCATCTAGG + Intronic
1068852690 10:61762377-61762399 CCATTGGCCTGAAGCCATCCTGG + Intronic
1069612301 10:69782480-69782502 CCAGTCTGATCAAACCATCCTGG - Intergenic
1069773507 10:70913862-70913884 CCATTCACCTCAAGCCCTGCTGG - Intergenic
1073008461 10:100342111-100342133 CCATTCTGAGCAAGCCATCTAGG - Intergenic
1074307460 10:112292288-112292310 CCATTCTCATCAGGACATGCTGG - Intronic
1080683582 11:34497336-34497358 GCATTCAGATCAAGCCTACCAGG - Intronic
1082945502 11:58754430-58754452 CCATCCACATCAAGCTACCAAGG + Intergenic
1084434395 11:69130472-69130494 CCACTCTCATCACGCCATCAAGG - Intergenic
1087646265 11:100811798-100811820 ACAATCAAATCAAGACATCCGGG - Intronic
1089100121 11:115956018-115956040 CCATCTACATCCAACCATCCTGG + Intergenic
1097277134 12:57821327-57821349 ACACTCCCACCAAGCCATCCTGG + Exonic
1101802312 12:108033218-108033240 CCATTCACAGCAAGGGATGCAGG - Intergenic
1102955906 12:117058911-117058933 CCTTTCACAGAAGGCCATCCTGG + Intronic
1103506591 12:121445267-121445289 CCACTCACCTTAAGGCATCCAGG + Exonic
1105866910 13:24469004-24469026 GCATGCACACCAAGCCATACCGG + Exonic
1106120778 13:26858598-26858620 CTCCTCACATCCAGCCATCCAGG - Intergenic
1108492011 13:50991422-50991444 CTCTCCACATCAAGCCTTCCAGG - Intergenic
1110478639 13:75947679-75947701 CCAGTCATATCAAGCCGTCCAGG - Intergenic
1112288479 13:98124653-98124675 CCCTTCTCATAAAGCCTTCCTGG + Intergenic
1114531081 14:23396899-23396921 CCATTCCCATCAGGGCAGCCTGG + Intronic
1114536436 14:23425900-23425922 CCATTCCCATCAGGGCAGCCTGG + Intronic
1116722475 14:48517075-48517097 TCATTTACAACAAGCCACCCAGG - Intergenic
1118108601 14:62690272-62690294 TCTTTCACATCAAGTCATTCTGG + Intergenic
1121944617 14:98107651-98107673 CCGATCACTTCAATCCATCCTGG - Intergenic
1125081791 15:35683088-35683110 GCATCCAAATGAAGCCATCCTGG + Intergenic
1125794166 15:42392260-42392282 CCCTTCCCCTGAAGCCATCCAGG - Intronic
1128795076 15:70460611-70460633 GCATTTACATTAAGACATCCTGG - Intergenic
1128861530 15:71078068-71078090 CCATTCAATCCATGCCATCCTGG + Intergenic
1129609991 15:77045374-77045396 CCAGTCACACCAATTCATCCTGG + Exonic
1129771648 15:78206770-78206792 CCATTCAGATGAAGCCATTGAGG + Intronic
1132106532 15:99066798-99066820 CCATTCCCACCAAGCCACTCAGG - Intergenic
1132564298 16:613888-613910 CCCTTCACAGCAAGCCAGTCAGG - Intronic
1133934990 16:10261713-10261735 CCAAGCACATCCAGGCATCCAGG - Intergenic
1138399691 16:56735486-56735508 CCATTCACAGGGATCCATCCAGG - Intronic
1140925486 16:79578962-79578984 CCAGTAACAACAAGCCAGCCAGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1145179520 17:20733850-20733872 CCATTCACTGCACTCCATCCTGG + Intergenic
1155148754 18:23105766-23105788 CCATTCACAGGAAGCCAGCGTGG + Intergenic
1158550489 18:58431447-58431469 CCTTTAACATGAAGCCAGCCGGG + Intergenic
1160660294 19:295076-295098 CCAGTCACATCAAGAGATGCAGG - Intergenic
1167949289 19:53013519-53013541 CCAATTTCAACAAGCCATCCAGG + Intergenic
1168265346 19:55220466-55220488 CCATGCTCATCAGGGCATCCAGG + Intergenic
925546243 2:5019938-5019960 CCATTCTCATCTAGACATCTAGG - Intergenic
928192920 2:29190300-29190322 CCACTCACATCCAGCCCTCTTGG - Intergenic
928756820 2:34536436-34536458 CCATTCATCTCAAGGCATTCAGG + Intergenic
929236313 2:39608829-39608851 CAATTCACATCAAGCCTAGCTGG - Intergenic
930011211 2:46940095-46940117 CCTTTCACATGAAGCCACACAGG - Intronic
931849883 2:66242020-66242042 CCACTCACATCAAGCCTCTCAGG + Intergenic
932574059 2:72953194-72953216 CCATTCCCATCCATCCCTCCTGG + Intronic
932708889 2:74047734-74047756 CCATTCAGATCAAGAAGTCCAGG + Exonic
932771073 2:74501138-74501160 ACATTCACATAATGCCCTCCTGG + Intronic
933336064 2:80961224-80961246 CCATTCAGATCAATGAATCCAGG - Intergenic
937142914 2:119617474-119617496 CCATTAGCAACAAGCCAGCCTGG - Intronic
937197208 2:120169323-120169345 CCATTCACAAAAATCCATTCTGG + Intronic
938772782 2:134514515-134514537 CCATGCACTGAAAGCCATCCTGG + Intronic
940175704 2:150875499-150875521 CCTTTCTTATCAAGCCCTCCAGG - Intergenic
942200994 2:173571238-173571260 CTATTCAAATGCAGCCATCCTGG + Intergenic
942226558 2:173821817-173821839 CCAGTCACATGGGGCCATCCTGG - Intergenic
943252019 2:185535797-185535819 GCATTCACTTTAAGCAATCCTGG + Intergenic
943765435 2:191656036-191656058 ACATTCACAGCCAGCCTTCCTGG + Intergenic
947983310 2:234427878-234427900 CCACCCACCTCAAGCCCTCCAGG + Intergenic
1172060155 20:32181938-32181960 CCATGCACCTCCAGCCCTCCAGG - Intergenic
1172160255 20:32863066-32863088 CCCTTCAGATCAAGCCAAGCTGG + Intronic
1178982522 21:37276797-37276819 ACATACACATGAAGCCATCTCGG + Intergenic
1179306208 21:40155828-40155850 CTTTTCTCATCAAGACATCCAGG - Intronic
1179990390 21:44945297-44945319 CCACCCACATCAAGCGTTCCTGG - Intronic
1180002510 21:45001731-45001753 GCATTCACACCTGGCCATCCTGG - Intergenic
1183192729 22:36332040-36332062 CAACTCTGATCAAGCCATCCTGG - Intronic
951796547 3:26545100-26545122 CCATTCCCATGAATCCAACCAGG - Intergenic
953740388 3:45533621-45533643 CCATTTACATCAGTCCTTCCTGG - Intronic
956601951 3:71032145-71032167 CCATTCACAGGAAGGCATCGGGG - Intronic
962981110 3:140490842-140490864 CCATTCACATGAATGCTTCCTGG - Intronic
966386509 3:179404734-179404756 CAATACACATTAAGCCATACTGG - Intronic
966930880 3:184674729-184674751 CCATTCACAGCAAGCCTGTCAGG - Intronic
977821537 4:101477693-101477715 ACATTCAGATTAAGCCATTCAGG - Intronic
978334735 4:107654307-107654329 GCTTTCACATCAAACCACCCTGG + Intronic
978934774 4:114360821-114360843 CCCTTCAAATCCAGCCATTCTGG - Intergenic
980554712 4:134388138-134388160 ACATACACACCAAGGCATCCTGG + Intergenic
985272985 4:188211642-188211664 CCCTTCACATAAAGTCCTCCAGG + Intergenic
987803457 5:22729307-22729329 CCTGTAACTTCAAGCCATCCAGG + Intronic
988499277 5:31770679-31770701 CCATTTACATCAGGCTATTCTGG - Intronic
989568846 5:42926541-42926563 CCATGCAGATAAAGCCCTCCAGG + Intergenic
990454420 5:55971190-55971212 CCACTCCCATCCAGACATCCAGG + Intronic
991515162 5:67427105-67427127 CCACTCTGATCTAGCCATCCTGG + Intergenic
992633408 5:78703150-78703172 AGGATCACATCAAGCCATCCTGG - Intronic
995207951 5:109503966-109503988 CCATTTTCATCAAGCCACCTAGG - Intergenic
997318122 5:132954921-132954943 CCTTTCACATCCTGCCCTCCTGG + Intronic
1005650180 6:27878801-27878823 ACACTCCCACCAAGCCATCCTGG + Intergenic
1006593771 6:35177803-35177825 CCTATCACATGAATCCATCCCGG - Intergenic
1008653500 6:53587498-53587520 CCTTTCAGATTAAGTCATCCAGG - Intronic
1011884424 6:92076325-92076347 TCACTCATATCAAGCCATTCAGG - Intergenic
1017161023 6:151366206-151366228 CCTTTCACATCTAGCCAACAGGG - Exonic
1017502178 6:155035828-155035850 CCATTTACATCAACCCAGCAAGG - Intronic
1019652908 7:2170254-2170276 ACGTGCACATAAAGCCATCCTGG + Intronic
1023497717 7:40815824-40815846 CCATTCACAGGCAGACATCCAGG - Intronic
1024828472 7:53420362-53420384 CCATTCACATGAATCTATCAAGG + Intergenic
1025920703 7:65909368-65909390 CCATTCCCATCACGACATCTCGG - Intronic
1026100629 7:67381664-67381686 CATTTCACATCAAGCCAGACAGG + Intergenic
1026890090 7:73976854-73976876 CCTTTTCCATCAAACCATCCAGG - Intergenic
1030269900 7:107660267-107660289 CAATCCAAATCAAGCCGTCCAGG - Intergenic
1030461209 7:109839205-109839227 ACACTCCCACCAAGCCATCCTGG - Intergenic
1032848388 7:135771415-135771437 CCATCCCCATCAAGGCATCAAGG + Intergenic
1035667692 8:1391152-1391174 CAATTCCCATCTAGCCAACCGGG - Intergenic
1036584224 8:10108218-10108240 ACATTCACATCAGGCCTTCCTGG + Intronic
1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG + Intergenic
1044839984 8:96329240-96329262 CCATTCACATCAAGCCATCCTGG - Intronic
1048546709 8:135394365-135394387 CTATACACCTCAGGCCATCCTGG + Intergenic
1055009135 9:71544520-71544542 CAATCCACATTGAGCCATCCAGG + Intergenic
1061297724 9:129686111-129686133 CCACCCACTACAAGCCATCCTGG - Intronic
1190212474 X:48459453-48459475 CCTTTCACCTCCAGCCATCCTGG + Intronic
1202605174 Y:26633325-26633347 GCATGCACACCAAGCCATACTGG + Intergenic