ID: 1044845531

View in Genome Browser
Species Human (GRCh38)
Location 8:96376882-96376904
Sequence GTGTGGGCCCAGAAAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044845520_1044845531 13 Left 1044845520 8:96376846-96376868 CCCACCCTGGAGGCCACAGGCAT No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data
1044845526_1044845531 0 Left 1044845526 8:96376859-96376881 CCACAGGCATAGATGGAGGTCCT No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data
1044845523_1044845531 8 Left 1044845523 8:96376851-96376873 CCTGGAGGCCACAGGCATAGATG No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data
1044845519_1044845531 14 Left 1044845519 8:96376845-96376867 CCCCACCCTGGAGGCCACAGGCA No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data
1044845522_1044845531 9 Left 1044845522 8:96376850-96376872 CCCTGGAGGCCACAGGCATAGAT No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data
1044845521_1044845531 12 Left 1044845521 8:96376847-96376869 CCACCCTGGAGGCCACAGGCATA No data
Right 1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044845531 Original CRISPR GTGTGGGCCCAGAAAAGTGA GGG Intergenic
No off target data available for this crispr