ID: 1044850117

View in Genome Browser
Species Human (GRCh38)
Location 8:96419625-96419647
Sequence AATCACATGGGGAAGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044850117_1044850131 22 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850131 8:96419670-96419692 AGGACGGCCAGACCCTGGGAGGG No data
1044850117_1044850123 -6 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850123 8:96419642-96419664 GTGATTCTCATGGGCAACCCAGG No data
1044850117_1044850124 2 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850124 8:96419650-96419672 CATGGGCAACCCAGGCTGACAGG No data
1044850117_1044850125 6 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850125 8:96419654-96419676 GGCAACCCAGGCTGACAGGACGG No data
1044850117_1044850134 30 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850134 8:96419678-96419700 CAGACCCTGGGAGGGCGGCCTGG No data
1044850117_1044850130 21 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850130 8:96419669-96419691 CAGGACGGCCAGACCCTGGGAGG No data
1044850117_1044850132 25 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850132 8:96419673-96419695 ACGGCCAGACCCTGGGAGGGCGG No data
1044850117_1044850129 18 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850129 8:96419666-96419688 TGACAGGACGGCCAGACCCTGGG No data
1044850117_1044850128 17 Left 1044850117 8:96419625-96419647 CCTGAAAGCTTCCCCATGTGATT No data
Right 1044850128 8:96419665-96419687 CTGACAGGACGGCCAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044850117 Original CRISPR AATCACATGGGGAAGCTTTC AGG (reversed) Intergenic
No off target data available for this crispr