ID: 1044850562

View in Genome Browser
Species Human (GRCh38)
Location 8:96423290-96423312
Sequence CTGGATATACGAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044850562_1044850568 26 Left 1044850562 8:96423290-96423312 CCTTTGCCCATTCGTATATCCAG No data
Right 1044850568 8:96423339-96423361 TGGGAGTTCCTTAAATAGTTTGG No data
1044850562_1044850566 6 Left 1044850562 8:96423290-96423312 CCTTTGCCCATTCGTATATCCAG No data
Right 1044850566 8:96423319-96423341 GTTTTGTTTTTGTTAAGTTGTGG No data
1044850562_1044850567 7 Left 1044850562 8:96423290-96423312 CCTTTGCCCATTCGTATATCCAG No data
Right 1044850567 8:96423320-96423342 TTTTGTTTTTGTTAAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044850562 Original CRISPR CTGGATATACGAATGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr