ID: 1044853550

View in Genome Browser
Species Human (GRCh38)
Location 8:96452364-96452386
Sequence TCTTGCTGGCCAGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044853550_1044853563 16 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853563 8:96452403-96452425 GGCTCGGGGGACCCAGCACTCGG No data
1044853550_1044853564 21 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853564 8:96452408-96452430 GGGGGACCCAGCACTCGGAGCGG No data
1044853550_1044853565 25 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853565 8:96452412-96452434 GACCCAGCACTCGGAGCGGCCGG No data
1044853550_1044853559 1 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853559 8:96452388-96452410 TTCCGGGTGGGCGTGGGCTCGGG No data
1044853550_1044853558 0 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853558 8:96452387-96452409 GTTCCGGGTGGGCGTGGGCTCGG 0: 615
1: 639
2: 402
3: 209
4: 255
1044853550_1044853557 -5 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853557 8:96452382-96452404 CAAGAGTTCCGGGTGGGCGTGGG No data
1044853550_1044853556 -6 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853556 8:96452381-96452403 GCAAGAGTTCCGGGTGGGCGTGG No data
1044853550_1044853562 3 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853562 8:96452390-96452412 CCGGGTGGGCGTGGGCTCGGGGG 0: 86
1: 601
2: 586
3: 370
4: 512
1044853550_1044853560 2 Left 1044853550 8:96452364-96452386 CCGGCGCTTGCTGGCCAGCAAGA No data
Right 1044853560 8:96452389-96452411 TCCGGGTGGGCGTGGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044853550 Original CRISPR TCTTGCTGGCCAGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr