ID: 1044859680

View in Genome Browser
Species Human (GRCh38)
Location 8:96510657-96510679
Sequence CCTACAATGGAGTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044859672_1044859680 4 Left 1044859672 8:96510630-96510652 CCCTACTGCCACTCAACATGTAT 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG No data
1044859673_1044859680 3 Left 1044859673 8:96510631-96510653 CCTACTGCCACTCAACATGTATC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG No data
1044859674_1044859680 -4 Left 1044859674 8:96510638-96510660 CCACTCAACATGTATCTGTCCTA 0: 1
1: 0
2: 0
3: 18
4: 154
Right 1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044859680 Original CRISPR CCTACAATGGAGTTGGAGGA GGG Intronic
No off target data available for this crispr