ID: 1044860548

View in Genome Browser
Species Human (GRCh38)
Location 8:96519108-96519130
Sequence ACCGCAGAGGGATGTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044860548_1044860558 4 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860558 8:96519135-96519157 GGAGCCTTGCTAGGGGAGAGAGG No data
1044860548_1044860561 7 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860561 8:96519138-96519160 GCCTTGCTAGGGGAGAGAGGGGG No data
1044860548_1044860560 6 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860560 8:96519137-96519159 AGCCTTGCTAGGGGAGAGAGGGG No data
1044860548_1044860555 -5 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860555 8:96519126-96519148 GCGGTGGGAGGAGCCTTGCTAGG No data
1044860548_1044860559 5 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860559 8:96519136-96519158 GAGCCTTGCTAGGGGAGAGAGGG No data
1044860548_1044860556 -4 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860556 8:96519127-96519149 CGGTGGGAGGAGCCTTGCTAGGG No data
1044860548_1044860557 -3 Left 1044860548 8:96519108-96519130 CCTCTCCTACATCCCTCTGCGGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1044860557 8:96519128-96519150 GGTGGGAGGAGCCTTGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044860548 Original CRISPR ACCGCAGAGGGATGTAGGAG AGG (reversed) Intronic
900882330 1:5391051-5391073 CCTGCAGAGGCATGGAGGAGGGG + Intergenic
902810460 1:18885226-18885248 AGGACAGAGGGATGGAGGAGAGG + Intronic
905219422 1:36434105-36434127 ACGTCTGAGGGATGTGGGAGCGG + Intronic
908142309 1:61198921-61198943 ACTTCAGAGTGATGAAGGAGGGG - Intronic
910981832 1:92965802-92965824 ACTGAAGTGGGAGGTAGGAGAGG - Intergenic
914685884 1:149978743-149978765 ACCTCAGAGGAATGTTGGATTGG - Intronic
915219877 1:154366234-154366256 GCGGCAGAGGGACGTGGGAGTGG - Intergenic
920186259 1:204161247-204161269 AGGGCAGGGGGATGGAGGAGAGG + Intronic
922194173 1:223345506-223345528 CCCCCTGAGGGATGCAGGAGAGG - Intronic
923000744 1:230004664-230004686 AGGGCACAGGGATGTGGGAGAGG + Intergenic
924420162 1:243901394-243901416 ACCACAGAAGAATGGAGGAGGGG - Intergenic
924916782 1:248578202-248578224 ACTGCTGGGGGATGAAGGAGTGG - Intergenic
1064145533 10:12823590-12823612 ACAGCAGAGGGAGGAAAGAGTGG + Intronic
1071016098 10:80998654-80998676 ACTGCAGTGGGATGAAGGAGAGG + Intergenic
1072532285 10:96330801-96330823 TCCCCAGAGTGATGCAGGAGGGG - Intronic
1073678724 10:105679143-105679165 ACTGCTGGGGGATGCAGGAGAGG - Intergenic
1074458278 10:113614173-113614195 ACTGCAGAGTGATGTAAGTGGGG - Exonic
1076616730 10:131759941-131759963 ACAGAAGAGGGAGGCAGGAGAGG - Intergenic
1079571707 11:21952076-21952098 ACTGCTGGGGGATGGAGGAGAGG - Intergenic
1080096864 11:28418712-28418734 ACTGCAGAAGGATGGGGGAGGGG - Intergenic
1080590098 11:33715787-33715809 ACAGCAGAGGTAGGGAGGAGAGG - Intronic
1083278297 11:61609974-61609996 AGTGCAGAGGGATGGGGGAGGGG + Intergenic
1084357889 11:68651726-68651748 ACCGCAGAGGGAGGGAGGGAGGG + Intergenic
1084583813 11:70042100-70042122 ACAGCAGAAGGATGCATGAGAGG + Intergenic
1090121651 11:124035574-124035596 ACAGCAGAGGGAATTGGGAGTGG - Intergenic
1095173310 12:39060572-39060594 TCAGCAAAGGGATGTAGGGGTGG - Intergenic
1096313025 12:50538248-50538270 ACCTCAGAGGGAGGTTGGTGTGG + Intronic
1102967807 12:117141498-117141520 ACCGCAGATGGCTGCAGCAGCGG - Intergenic
1103743688 12:123107940-123107962 AGCACAGAGGGAGGAAGGAGAGG + Intronic
1104038727 12:125115774-125115796 ACTGCACACAGATGTAGGAGTGG + Intronic
1104135916 12:125938539-125938561 ACCACAGTGGGTTGTAGGATTGG + Intergenic
1106138969 13:26994857-26994879 ACCGCAGAGGGGAGCAGAAGGGG - Intergenic
1112387882 13:98957103-98957125 GCTGCAGAGGGAAGGAGGAGGGG - Intronic
1112862072 13:103843416-103843438 ACCCTAGAGGGAAGAAGGAGAGG + Intergenic
1116220500 14:42079913-42079935 ATCAAAGAGAGATGTAGGAGTGG - Intergenic
1117668643 14:58082879-58082901 ACCCCAGCTGGATGGAGGAGGGG - Intronic
1119109389 14:71957428-71957450 AGGACAGAGGGCTGTAGGAGAGG + Intronic
1119619086 14:76118214-76118236 CCAGCAAAGGGATGCAGGAGGGG + Intergenic
1119986752 14:79147021-79147043 ACAGCAGAAAGATGTATGAGGGG + Intronic
1122312002 14:100803350-100803372 ACACCAGAGGGATGTGGGAGGGG - Intergenic
1124066109 15:26345636-26345658 ACTGAAGAGGGATGTGGGATGGG + Intergenic
1124425411 15:29558664-29558686 ACTGCAGAGGGAGTCAGGAGAGG - Intronic
1125788430 15:42343608-42343630 AGAGCAGAGGAATGTGGGAGGGG - Intronic
1127961584 15:63894558-63894580 ACAGCAGAGGCATGTGGGAAGGG + Intergenic
1128234809 15:66060078-66060100 ACAGCAGAGGGATGAAGGATGGG + Intronic
1128877722 15:71215598-71215620 ACCACAGAGTGAGGTGGGAGTGG - Intronic
1129944165 15:79524661-79524683 TCCCCAGAGGGATGGTGGAGGGG + Intergenic
1130511657 15:84594757-84594779 ACTGCTGAGGGATGGGGGAGGGG - Intergenic
1131222913 15:90600038-90600060 ACCACAGTAGGAGGTAGGAGAGG - Intronic
1131323658 15:91421653-91421675 GCTGCTGAGGGATGGAGGAGGGG + Intergenic
1135482736 16:22835246-22835268 ACCTCAGAGGGAAGTAACAGGGG - Intronic
1136421603 16:30137602-30137624 ACCCAAAAGGGATGAAGGAGTGG + Intergenic
1137474275 16:48793456-48793478 ACCCCAGAGGGAGGTGAGAGAGG + Intergenic
1140452667 16:75083447-75083469 ACCTCAGAGATATGTTGGAGTGG + Intronic
1141549388 16:84795209-84795231 GCCGCAGCGAGATGAAGGAGAGG - Intergenic
1143768378 17:9152276-9152298 ACAGCAGGGGGATTTAGCAGAGG - Intronic
1146093190 17:29902774-29902796 ATCGTAGAGGCATCTAGGAGAGG + Intronic
1146098982 17:29960194-29960216 ACTGCTGGGGGATGGAGGAGGGG + Intronic
1147971621 17:44221343-44221365 AACGCAGAGCGATGGAGGCGGGG - Exonic
1148025987 17:44587925-44587947 ACCTGAGAGGGAAGGAGGAGAGG - Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149453890 17:56771711-56771733 ACTGGAGAGGGAGGCAGGAGGGG + Intergenic
1149989032 17:61370136-61370158 ACAGCTGAGGGATTCAGGAGAGG + Intronic
1152827984 17:82479491-82479513 GCCGCAGAGGGTTGTGGGAAGGG - Intronic
1156478437 18:37421099-37421121 CCCGGAGAGGGATGTTGGGGAGG - Intronic
1156652708 18:39243873-39243895 AAAGCAGAGTGATGTGGGAGAGG - Intergenic
1156735789 18:40257293-40257315 ACCACAGAGGTAAGTAGCAGAGG - Intergenic
1157371088 18:47112677-47112699 ACCACAGAGGGATGAAGCAAAGG - Intronic
1157765333 18:50292369-50292391 AGAGCAGAGGGGTGTAGCAGAGG + Intergenic
1165087840 19:33363729-33363751 AGGGCAGAGGGAAGTGGGAGAGG - Intergenic
1165308339 19:35015765-35015787 CCCGCAGAGGGAGGGAGGAGTGG + Intronic
1167769020 19:51502180-51502202 GCCGCTGAGGGAGGAAGGAGAGG - Intergenic
925193812 2:1907535-1907557 AGATCAGAGGGAGGTAGGAGGGG + Intronic
931456373 2:62412568-62412590 ACCCCAGAGGTGTGTAGAAGAGG - Intergenic
932460126 2:71876517-71876539 TCCTGAGAGGGATGTGGGAGAGG - Intergenic
932779969 2:74553835-74553857 ACCGCAGAGGGAATGAGTAGGGG - Intronic
933785549 2:85838385-85838407 CCCCCTGAGGGATGTAGGGGTGG + Intergenic
935953540 2:108352453-108352475 GTGGCAGAGGGATGGAGGAGAGG + Intergenic
941918734 2:170828848-170828870 ACCGCAGAGGGAGGAAGGCGAGG - Intronic
942801747 2:179883607-179883629 ACAGCAGAGGGCTGTAGAGGTGG + Intergenic
946373440 2:219294515-219294537 GACGGAGAGGGATGAAGGAGGGG + Intronic
946630291 2:221659737-221659759 ACCAATGAGGGATGGAGGAGAGG + Intergenic
948586112 2:239020769-239020791 GCCCCAGAGGGAGGCAGGAGGGG - Intergenic
948976296 2:241465767-241465789 ACAGGCGAGGGATGGAGGAGGGG - Intronic
1171364897 20:24617011-24617033 GCCGCAGAGGGCTGTGGAAGCGG - Intronic
1172602024 20:36190597-36190619 GCAGCAGAGGGATGCAGGGGAGG - Intronic
1172602152 20:36191169-36191191 GCAGCAGAGGGATGCAGGGGAGG - Intronic
1173434005 20:43016373-43016395 ACAGCAGAGGGAAGTAACAGAGG - Intronic
1173620123 20:44430144-44430166 ACAGCAGAGGGAGGCAGCAGAGG - Exonic
1174737004 20:52973677-52973699 CACGCAGAGGGATGCAGGGGTGG - Intronic
1175935201 20:62510834-62510856 TCAGCAGAAGGATGGAGGAGTGG - Intergenic
1177051620 21:16241963-16241985 ACCACAGAGGGAGGTGGGAAGGG - Intergenic
1178013966 21:28320638-28320660 ATGGCAGAGGGAAGTAGGTGTGG - Intergenic
1182437030 22:30337367-30337389 ACAGCAGAGGACTGCAGGAGGGG + Intronic
1184066302 22:42123744-42123766 TCTGCAGAGGGAGGTGGGAGGGG - Intergenic
1184068770 22:42135896-42135918 TCTGCAGAGGGAGGTGGGAGGGG - Intergenic
950492620 3:13315118-13315140 ACTGCAAAGGCATGTGGGAGAGG + Intergenic
952688574 3:36176916-36176938 AGCACAGAGGGCTGTAGGACAGG + Intergenic
952820332 3:37480974-37480996 ACCACAGGGGGACGTAGGAATGG - Intronic
954285666 3:49617376-49617398 AGGGCAGAGAGATGAAGGAGTGG - Intronic
956059366 3:65334127-65334149 ACCTCAGAGGGATTATGGAGAGG + Intergenic
956521591 3:70110059-70110081 ACCACAGGGTGCTGTAGGAGAGG + Intergenic
957082774 3:75650819-75650841 ATGGCAGAAGGATGAAGGAGTGG - Intergenic
957384823 3:79482765-79482787 ACCATAGAGGGATGTAGAATTGG + Intronic
957729537 3:84115585-84115607 TCCGCAAAGGGAGTTAGGAGTGG + Intergenic
960934430 3:122888936-122888958 ACAGCGGAGGTATGGAGGAGAGG - Intergenic
962184656 3:133245294-133245316 TGTGCAGAGGGATGTAGGAGAGG - Intronic
964944668 3:162205823-162205845 ACAGCAGAGGGATTTGGGGGTGG - Intergenic
965863464 3:173175474-173175496 ACCTCAGAAGGTTGTAGGTGTGG + Intergenic
969993350 4:11287189-11287211 ACTACAGAGGCATGTAGGAAGGG - Intergenic
971091190 4:23347488-23347510 ACAACAGAGGGATGTTGGAAGGG + Intergenic
984403665 4:179299675-179299697 ACAGGAGAGAGATGTAGGATGGG + Intergenic
987372033 5:17202356-17202378 ACCGCAGAAGGATGTAGGGTAGG - Intronic
988082606 5:26432979-26433001 ACTGCTGGGGGATGTGGGAGGGG - Intergenic
988891793 5:35625493-35625515 ACCCCAGAGGGAGGCAGGAAGGG + Intronic
990841361 5:60082967-60082989 ACCTCAGATGGAGGGAGGAGAGG - Intronic
995523877 5:113035398-113035420 AGGGCAGAGGGATGCAGGGGAGG - Intronic
997776985 5:136618466-136618488 ACCTCAGAGGGCTGTTGGAGAGG - Intergenic
998471870 5:142389894-142389916 AGGGCAGAGGGACGTAGGAGAGG + Intergenic
999096421 5:148981861-148981883 ACCACAGGGTGATGTAGCAGAGG - Intronic
999666984 5:153922826-153922848 ACTGGAGAGGGAAGCAGGAGAGG - Intergenic
1001565487 5:172696847-172696869 ACCTCAGAGGGATGGAGATGGGG + Intergenic
1001913423 5:175540097-175540119 AGAGCAGAGGGGTGGAGGAGAGG + Intergenic
1008065930 6:47048123-47048145 GCCACAGAAGGCTGTAGGAGAGG + Intergenic
1008252539 6:49258078-49258100 ACAGAAGAAGCATGTAGGAGAGG - Intergenic
1013174896 6:107668774-107668796 AGCGAAGAGGGATGGAGGAGAGG - Intergenic
1014180989 6:118384052-118384074 AGGGCAGAGGGAAGGAGGAGTGG + Intergenic
1014625683 6:123721695-123721717 ATCAAAGGGGGATGTAGGAGTGG + Intergenic
1019162108 6:170075786-170075808 AGCCCGGAGGGATGTAGGAAAGG + Intergenic
1019447017 7:1076584-1076606 ACCGGGGAGGGATGTAAGAAAGG + Intronic
1019577490 7:1744506-1744528 CCCCCAGAGGGATGGAGGGGCGG - Exonic
1021534498 7:21688204-21688226 AGGGGAGAGAGATGTAGGAGAGG - Intronic
1022479705 7:30734733-30734755 GCAGCAGAGGGAGCTAGGAGAGG - Intronic
1028161562 7:87491769-87491791 ACCCCAGAGGGAAGTGGGTGGGG + Intergenic
1029254945 7:99263242-99263264 ACAGGAGAGAGCTGTAGGAGGGG + Intergenic
1029590967 7:101506835-101506857 ACCTAAGAGGGAAGTTGGAGAGG - Intronic
1032715652 7:134506974-134506996 ACTGCAGAGGGAAGCTGGAGAGG + Intergenic
1036117150 8:5971027-5971049 ACCGCAGAGGGAGAGAGGGGAGG + Intergenic
1037477742 8:19273974-19273996 ACAGCACAGGGATGTGGGAGTGG + Intergenic
1039808971 8:41027762-41027784 ACCGCTGAGGTGTGTAGCAGTGG - Intergenic
1041441835 8:57905235-57905257 AGGGCAGTGGCATGTAGGAGAGG + Intergenic
1041451085 8:58007467-58007489 ATAGCAGAGGGATGGAGGGGTGG - Intronic
1042102509 8:65288694-65288716 GCCTGAGAAGGATGTAGGAGTGG - Intergenic
1044860548 8:96519108-96519130 ACCGCAGAGGGATGTAGGAGAGG - Intronic
1045011093 8:97958943-97958965 ACAGAAGAGGGAAGCAGGAGAGG - Intronic
1047204778 8:122794354-122794376 ACCTCAGTGGCATGGAGGAGGGG - Intronic
1048362203 8:133707304-133707326 ATAGCATAGGGATGGAGGAGTGG + Intergenic
1049609032 8:143544284-143544306 AGCCCAGATGGATCTAGGAGAGG + Intergenic
1052972363 9:34384941-34384963 GGGGCAGAGGGATGCAGGAGAGG + Intronic
1053417102 9:37953674-37953696 AGCACAGAGGGAGGTAGGAGGGG - Intronic
1053511791 9:38693908-38693930 ACAGCAGAGGGATGTAAACGGGG - Intergenic
1059331555 9:113538786-113538808 ACAGGAGAAGGATGAAGGAGGGG + Intronic
1060818797 9:126650071-126650093 TCTGCTGGGGGATGTAGGAGAGG - Intronic
1061321766 9:129835389-129835411 ACGGCAGAGGGAAGGAGGTGGGG + Intronic
1185620556 X:1450809-1450831 ACCGCCTAGGGATGTGGGTGGGG - Intronic
1185620660 X:1451090-1451112 ACCGCCTAGGGATGGGGGAGGGG - Intronic
1186002336 X:5026728-5026750 ACCTCAGAGTGATGTCGGAAAGG + Intergenic
1188187749 X:27136032-27136054 ACCCAAGAGTGATGTAGGACTGG - Intergenic
1191834230 X:65446716-65446738 ACTGCAGAGGAATGCAGAAGGGG + Intronic
1193004927 X:76605951-76605973 GCTGCTGAGGGATGGAGGAGGGG - Intergenic
1193308524 X:79977394-79977416 ACAGAAGAGGGAGGTAGGAAGGG + Intergenic
1196618722 X:117797432-117797454 ATCTCAGGGGGATGTGGGAGAGG - Intergenic