ID: 1044863818

View in Genome Browser
Species Human (GRCh38)
Location 8:96549739-96549761
Sequence CTTATTGAGTCCCTAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044863818 Original CRISPR CTTATTGAGTCCCTAAACAA AGG (reversed) Intronic
908000668 1:59675551-59675573 CTGAGTGAGTCTTTAAACAAAGG + Intronic
910188095 1:84567067-84567089 TTTATTGAGTGCCTAATTAAGGG - Intronic
911684894 1:100764378-100764400 CTCATTAAGTCTCTAAATAAGGG + Intergenic
912254807 1:108047752-108047774 CTTATTGAGCACCTAACCATGGG - Intergenic
915771023 1:158423852-158423874 TTTATTGAGTTCCTAAAGACTGG + Intergenic
1063542246 10:6945598-6945620 TTTATTGAAACCCTAAAGAAAGG - Intergenic
1068705039 10:60066201-60066223 TTTATTAAGTCTCTAGACAATGG - Intronic
1072850687 10:98888579-98888601 CTTATACAATCCCTAAACAGAGG - Intronic
1073293019 10:102422643-102422665 CTTTTTCCGTCCCTACACAAGGG - Intronic
1077873360 11:6281958-6281980 CATGCTGAGCCCCTAAACAAAGG + Intergenic
1080427226 11:32167275-32167297 TTCATTGAGCCCCCAAACAACGG + Intergenic
1087389350 11:97514343-97514365 CTTATGGAATACCTAGACAAAGG - Intergenic
1090175921 11:124649618-124649640 CCTGTGGGGTCCCTAAACAAGGG - Exonic
1091284557 11:134401223-134401245 ATTATTGAGTGTCTACACAAAGG + Intronic
1091732138 12:2889235-2889257 CTTATGTAGTCCCTAAAACAGGG - Exonic
1092813190 12:12290415-12290437 CTTATTGAGTTCATAGACAAAGG - Intergenic
1096055894 12:48651641-48651663 GGTAATGAGTCTCTAAACAAAGG - Intergenic
1096199183 12:49669359-49669381 CTTATTCAGTCACCAAACAGTGG - Intronic
1097516331 12:60612143-60612165 CTTATTGTATCCATAAAAAATGG - Intergenic
1097884328 12:64713730-64713752 CTTATTAAGTGTCTAAACTAAGG - Exonic
1098458276 12:70701661-70701683 CTGAGTGAATCCCTAAAAAATGG + Intronic
1099113338 12:78590910-78590932 TTTATTTATTCCTTAAACAATGG - Intergenic
1104461480 12:128959708-128959730 CTTGTTGATTCTCCAAACAAAGG + Intronic
1107088562 13:36451376-36451398 CTTTTGAAGTCCATAAACAAAGG + Intergenic
1109869455 13:68314211-68314233 CTTATTCAGTCCATAAATGATGG - Intergenic
1116974891 14:51105186-51105208 CTTGTTAAGTCTCTTAACAAGGG + Intergenic
1119448891 14:74690828-74690850 CTTATTGAGTCACTTATCACAGG + Intronic
1121369389 14:93342885-93342907 CTTATTGAGAACTAAAACAAAGG - Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1125438053 15:39669193-39669215 CATATTCAGTCCCTGAACAAGGG + Intronic
1131927662 15:97403421-97403443 CTTATGGAGTCTGGAAACAATGG - Intergenic
1134038220 16:11048400-11048422 CTTATGGAGTACCTAGCCAAGGG - Intronic
1137019291 16:35407503-35407525 CTTATTGAGGCCCTAATGAGTGG - Intergenic
1138780756 16:59782371-59782393 CTTATTAAGTACCATAACAAAGG - Intergenic
1141206195 16:81934895-81934917 CTTATTCAGTACCACAACAACGG + Intronic
1141917579 16:87110319-87110341 CTTATTGATATGCTAAACAAGGG + Intronic
1142589958 17:999405-999427 CTCATTCAGTCCCTACCCAAAGG - Intronic
1147018717 17:37513346-37513368 CTTACAGAGTCACTAAATAATGG - Exonic
1151864928 17:76795117-76795139 TCTTATGAGTCCCTAAACAATGG + Intergenic
1153706417 18:7749998-7750020 TTTTTTGACTCCCTAAGCAAAGG + Intronic
1153915966 18:9744445-9744467 CTTATTAATTCCCTAATTAATGG + Intronic
1156750265 18:40444735-40444757 ATTCTTGAGTGGCTAAACAAGGG + Intergenic
1157869494 18:51217000-51217022 CTTTTTGGGTCTCTGAACAAAGG + Intronic
1159373502 18:67560707-67560729 TTCATTGAGTCCCTAAACCATGG - Intergenic
1164571382 19:29377071-29377093 CATTTTGAGCCCCTAAACAAGGG + Intergenic
1165098410 19:33423238-33423260 CTTATTCAGTCACTCAACAGAGG - Intronic
1168549093 19:57278480-57278502 CTTAGTGACTTGCTAAACAAGGG + Intergenic
929041654 2:37750425-37750447 CTTACTGAGTCTCTCCACAAGGG + Intergenic
929736455 2:44555261-44555283 CTGATTGAGACCTTAAACTAGGG + Intronic
930383588 2:50662698-50662720 CTACTTGATGCCCTAAACAAGGG - Intronic
930970304 2:57386632-57386654 CTTATTTTCTCCCAAAACAAAGG - Intergenic
932652529 2:73574234-73574256 CTTATTAACACCCTAAACTAAGG - Intronic
933854319 2:86398659-86398681 CTTAATAAGTCTCTTAACAAAGG - Intergenic
935861465 2:107335868-107335890 CTTTTAAAGTCCTTAAACAAAGG - Intergenic
935942030 2:108249136-108249158 CCTAGTGAGACCCTAAACAGAGG + Intronic
942300732 2:174559028-174559050 CTTATTGAGTGCTTACACTAAGG + Intergenic
947415341 2:229889755-229889777 CCTAATGAGTCCCTAATAAATGG - Intronic
1170059134 20:12241110-12241132 CGTATTAACTCTCTAAACAAAGG + Intergenic
1170280077 20:14636478-14636500 CTTCTGGAGTCCCTAAGAAAGGG - Intronic
1171030753 20:21674457-21674479 CTTATTGAGTCACAACACCAAGG - Intergenic
1177450919 21:21264487-21264509 ATTATTCAGTACCTAAGCAAAGG + Intronic
1178175678 21:30095512-30095534 ATTTCTGAGTCCCAAAACAAAGG + Intergenic
1179005376 21:37509390-37509412 CTTATGGAATATCTAAACAACGG - Intronic
1182205101 22:28616109-28616131 ATTCTTGAGTTCTTAAACAATGG + Intronic
1203293877 22_KI270736v1_random:21945-21967 CTTACTGAGTCTCTCCACAAGGG + Intergenic
949247858 3:1946583-1946605 ATTATTGAGTCCCCAAACCAAGG - Intergenic
949669225 3:6378995-6379017 ATTTTTGAGTCCTAAAACAATGG - Intergenic
952768668 3:36977219-36977241 TTTATTGAGTCCCCAAACACCGG - Intergenic
953995902 3:47519567-47519589 CTTATTGAGTTTTTAAAAAAAGG + Intergenic
956185483 3:66558416-66558438 CTGGTTATGTCCCTAAACAATGG + Intergenic
956431970 3:69196144-69196166 CTTATTTATTCCCAAAATAATGG + Intronic
957656509 3:83084831-83084853 CTTCGTGAGTCCCTAAAAAGTGG - Intergenic
958932923 3:100226663-100226685 CTTTTTGAGTGCTTAAATAATGG - Intergenic
960255090 3:115503267-115503289 CTCAGAGAGACCCTAAACAATGG + Intergenic
961801002 3:129449262-129449284 CTTATTGATACACAAAACAATGG - Intronic
963015451 3:140820240-140820262 CTTATTGTGTGCCTGAACCATGG + Intergenic
967556678 3:190866911-190866933 CTTAATGAGTCAATAAATAAAGG - Intronic
971525647 4:27614292-27614314 CTTATTCAGTCTCTCAACCAAGG + Intergenic
976866807 4:89738327-89738349 CTTATTCAGTCACTACCCAAGGG - Intronic
982138537 4:152295645-152295667 CTTTTTCCTTCCCTAAACAATGG + Intergenic
983365982 4:166790033-166790055 CTAATTGAGTGACTAAACTATGG + Intronic
984957241 4:185057695-185057717 CAGATTGAGTCACTTAACAAAGG + Intergenic
986037696 5:3956552-3956574 TTCATTCAGTCCCTAAACGAGGG - Intergenic
986737224 5:10676681-10676703 GTTATTTAGTCCCTAGACCATGG + Intergenic
988894364 5:35656043-35656065 CTTATTGATTCATTAAACAAGGG + Intronic
992149302 5:73886649-73886671 CATAATGAGTCCTTAAAAAATGG - Intronic
994705043 5:103193805-103193827 CTTCTAGACTGCCTAAACAAAGG - Intronic
997053911 5:130417295-130417317 ATCATTGAGTACATAAACAAAGG + Intergenic
998940216 5:147273669-147273691 CTTATTGGGTACCCACACAAAGG + Intronic
1004197605 6:13519041-13519063 CTTATTGTGCCCCAAAGCAAAGG + Intergenic
1005278868 6:24249142-24249164 CCTGATGACTCCCTAAACAAAGG + Intronic
1009567927 6:65336870-65336892 CTTATGGAGTGCTTAAACACAGG + Intronic
1009812607 6:68688548-68688570 CCTACTGAGTGGCTAAACAATGG - Intronic
1011844280 6:91543851-91543873 CTTAATGGGTTCCTAAAAAATGG - Intergenic
1015222976 6:130825815-130825837 TTCATTGAATGCCTAAACAAAGG - Intergenic
1016648561 6:146438067-146438089 CTCATTGGTTCCCCAAACAAAGG + Intergenic
1017932467 6:158970339-158970361 CTTATAGAGCCACTCAACAAAGG - Intergenic
1018658850 6:166066754-166066776 TTTATTGACTCCCTTAACCAGGG - Intergenic
1020804194 7:12768125-12768147 CTTATTGAGTCCCCATGTAATGG - Intergenic
1024699942 7:51896045-51896067 CTTGTTGAGTACCTAGACAAGGG + Intergenic
1028183122 7:87748628-87748650 TTTATTGAGTGCCTAACCATAGG + Intronic
1028290187 7:89056155-89056177 CTTTTTGAGTCCCAACAAAAGGG + Intronic
1028854225 7:95572114-95572136 CTTATTCTGACCTTAAACAAAGG - Intergenic
1037266010 8:17061133-17061155 AGTAATGAGTCCCTGAACAAAGG + Intronic
1037346618 8:17907814-17907836 CCACTTGAGTCCCTGAACAAAGG - Intronic
1037347624 8:17916343-17916365 CCACTTGAGTCCCTGAACAAAGG - Intergenic
1037712513 8:21366546-21366568 CTTTTTGAGTTCCTAATCCATGG - Intergenic
1038128622 8:24703464-24703486 CTTATAGAGTCCCTCAGCACTGG - Intergenic
1038257471 8:25963347-25963369 CTTCTTTAATCCCTAAAGAATGG + Intronic
1041514378 8:58684303-58684325 CTCAGTGAGACCCTACACAATGG + Intergenic
1042152207 8:65799939-65799961 CTTTGTGAGTCCCTAAAAAAGGG - Intronic
1043160535 8:76841053-76841075 ATGATTGACCCCCTAAACAAGGG + Intronic
1043188309 8:77183745-77183767 CATAGTGAGTCCTTACACAAAGG - Intergenic
1044863818 8:96549739-96549761 CTTATTGAGTCCCTAAACAAAGG - Intronic
1044950984 8:97435051-97435073 CTAATTGAGTCCATAAACCAAGG - Intergenic
1046157827 8:110316723-110316745 AATATTGATTCCCTAAACAGTGG + Intergenic
1047013304 8:120695719-120695741 ATGATTGAGTCCCTCAATAAAGG - Intronic
1050003092 9:1099286-1099308 CTTATTGAGACCCTGGACAGAGG + Intergenic
1050244012 9:3668859-3668881 TTTATTTAGTCCTTAAGCAAAGG - Intergenic
1052045489 9:23789198-23789220 CTTATTCAGTCCCTATACAGAGG + Intronic
1054892926 9:70271520-70271542 TTTATTGAGTACCTATACATTGG + Intronic
1055280119 9:74664547-74664569 TTTATTGAGTATCTACACAATGG - Intronic
1055442676 9:76352158-76352180 CTTAATGATACGCTAAACAAAGG + Intronic
1186572408 X:10729085-10729107 CTTTGTGAGTCCCTAATGAATGG + Intronic
1189718452 X:43889327-43889349 ATTATTCAATCCATAAACAAGGG + Intergenic
1192306474 X:69965596-69965618 TTTAATGAGTTCCTAAATAATGG - Intronic
1197674033 X:129310582-129310604 CTTAGTGAGTCCCTTAACAGAGG - Intergenic
1198636524 X:138707831-138707853 CTTATTGAGACCCTCGTCAATGG + Intronic
1199055164 X:143285343-143285365 ATTAATGTTTCCCTAAACAATGG + Intergenic