ID: 1044864042

View in Genome Browser
Species Human (GRCh38)
Location 8:96551894-96551916
Sequence CTGTTTAAGAAAAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 990}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044864042_1044864047 0 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864047 8:96551917-96551939 GATGAGCCTGTTTACTGCTGGGG No data
1044864042_1044864054 29 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864054 8:96551946-96551968 TATGTATCCCCATGAGTCAGGGG No data
1044864042_1044864053 28 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864053 8:96551945-96551967 GTATGTATCCCCATGAGTCAGGG No data
1044864042_1044864048 1 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864048 8:96551918-96551940 ATGAGCCTGTTTACTGCTGGGGG No data
1044864042_1044864051 6 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864051 8:96551923-96551945 CCTGTTTACTGCTGGGGGCAGGG No data
1044864042_1044864045 -2 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864045 8:96551915-96551937 AGGATGAGCCTGTTTACTGCTGG No data
1044864042_1044864052 27 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864052 8:96551944-96551966 GGTATGTATCCCCATGAGTCAGG No data
1044864042_1044864046 -1 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864046 8:96551916-96551938 GGATGAGCCTGTTTACTGCTGGG No data
1044864042_1044864049 5 Left 1044864042 8:96551894-96551916 CCTTCTTCCTTTTTCTTAAACAG 0: 1
1: 0
2: 6
3: 87
4: 990
Right 1044864049 8:96551922-96551944 GCCTGTTTACTGCTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044864042 Original CRISPR CTGTTTAAGAAAAAGGAAGA AGG (reversed) Intronic
900739121 1:4319887-4319909 CTGTTGAGGATAAAGGATGAAGG + Intergenic
900779448 1:4608225-4608247 CTTTTTAAGAGAGAGGCAGAGGG - Intergenic
900875372 1:5338671-5338693 CTGTTATAGAAAAAGGCAAAGGG + Intergenic
901059186 1:6464276-6464298 CTGGTTCAGGAATAGGAAGAGGG - Intronic
901160052 1:7170083-7170105 CTGCTTAAGAAATTAGAAGAAGG - Intronic
901173425 1:7280644-7280666 CTATTTATTAAACAGGAAGAAGG - Intronic
901561216 1:10072431-10072453 CTGTTTGAAAAAAAAAAAGATGG - Intronic
902695779 1:18139926-18139948 TTTTTTAAAAAAAAGGAAGTTGG - Intronic
902798117 1:18812746-18812768 GGGTTCAAGAAAAAGGAAGGAGG + Intergenic
904191632 1:28749087-28749109 CTTTTCAGGAAAAAGGAAAAAGG - Intronic
905168319 1:36096505-36096527 CTTATTAAGGAAAAGGAAGTGGG + Exonic
905850324 1:41269298-41269320 ATGTTCAAGAAACAGCAAGAAGG - Intergenic
906313200 1:44768499-44768521 GTGTTAAAAAAAAAAGAAGATGG + Intergenic
906682852 1:47742474-47742496 CTGCTTAACAAAAAAAAAGAAGG + Intergenic
906773820 1:48510531-48510553 GTGTTTGAGAAATAGGAAGAAGG + Intergenic
907017224 1:51028620-51028642 CTCTTTCAGAAAATAGAAGAAGG + Intergenic
907025508 1:51114140-51114162 ATGTTTAACAAACAGAAAGAAGG + Intronic
907166605 1:52416982-52417004 CGGTTTAATAAAAAGGGAAAGGG - Exonic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
907806092 1:57821796-57821818 CTCTTAAAAAAAATGGAAGAAGG - Intronic
907850729 1:58252311-58252333 CTGCTTGAGAAAAAGACAGATGG - Intronic
908255804 1:62302666-62302688 CTGTCTATGAACCAGGAAGAGGG + Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908414260 1:63897541-63897563 CATTTTAGGAAAAAGAAAGAAGG - Intronic
908458367 1:64326091-64326113 ATGTCCAAGAAAAAGAAAGAGGG + Intergenic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909107612 1:71432199-71432221 CAGATTAAGTTAAAGGAAGATGG + Intronic
909122029 1:71615578-71615600 CTGTTTTAGAAATAGCAAAATGG + Intronic
909448450 1:75773130-75773152 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
909654838 1:78020149-78020171 CTGTCTCAAAAAAAGGAAGCTGG + Intronic
910387126 1:86696857-86696879 GTGATTTAGAAAAAAGAAGAAGG + Intergenic
910527965 1:88202639-88202661 ATGTTTGAGAAAAAGCAAGAAGG + Intergenic
910538502 1:88327600-88327622 CTTTTTATAAAAAATGAAGAAGG - Intergenic
910820929 1:91345327-91345349 GTGTTTAAGGAATAGCAAGAAGG + Intronic
911155493 1:94632728-94632750 CTGTTGAAGAAAATGAAAGAAGG - Intergenic
911158680 1:94660932-94660954 ATGTTAAAGGAAAAGGAACAGGG + Intergenic
911210997 1:95137737-95137759 CTGTTTCAGAAAAAAAGAGAAGG - Intronic
911616896 1:100023566-100023588 CTGTTTAAAATAAAGTAATATGG - Exonic
911725655 1:101238621-101238643 CTTTTTTCAAAAAAGGAAGAGGG - Intronic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
912082947 1:105960030-105960052 CTGTTTCAGAAAATTGAAGAAGG - Intergenic
912152708 1:106879828-106879850 CTCCTTAAGCAAAAGGAAGGAGG - Intergenic
912714840 1:111975782-111975804 CTGTTCTTGAAAAAGTAAGAAGG - Intronic
912760631 1:112363485-112363507 CTTTTTAAAAAACTGGAAGATGG - Intergenic
912871526 1:113311237-113311259 CTGCTTGAAAAAAAGGCAGAGGG + Intergenic
912976851 1:114338792-114338814 CTGATAAAGAGAAGGGAAGATGG + Intergenic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913250310 1:116907930-116907952 GTGGTTAAGAAAAGGAAAGATGG + Intergenic
913506133 1:119517595-119517617 CTGTTTAAGAAATTTGAAAAAGG - Intergenic
913572280 1:120132466-120132488 CTGTTTAAGAATCAGACAGAAGG + Intergenic
913966796 1:143383400-143383422 TGGTTTGAGAAACAGGAAGAAGG + Intergenic
914061173 1:144209007-144209029 TGGTTTGAGAAACAGGAAGAAGG + Intergenic
914117977 1:144757362-144757384 TGGTTTGAGAAACAGGAAGAAGG - Intergenic
914293202 1:146294110-146294132 CTGTTTAAGAATCAGACAGAAGG + Intergenic
914453449 1:147813569-147813591 CATTTTGAGAAAAATGAAGAAGG + Intergenic
914554246 1:148744893-148744915 CTGTTTAAGAATCAGACAGAAGG + Intergenic
914684459 1:149965928-149965950 CTGTTTCAGAAATAGGAAGGTGG - Intronic
914701642 1:150139336-150139358 ATGTTTAAGGAACAGAAAGAAGG - Intronic
915220827 1:154373099-154373121 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
915247330 1:154565930-154565952 CTGCTTAAGGAAAAGATAGAGGG - Intergenic
915496100 1:156283720-156283742 CTGTTTCAGGAACAGAAAGAAGG - Intronic
916072243 1:161177104-161177126 CTGCTGAAGAGAAAGGGAGAGGG + Intronic
916764166 1:167844328-167844350 CTGTTTTCCAAAAAGGGAGATGG + Intronic
917035036 1:170739372-170739394 CTTTTCAATAAAAAGAAAGAAGG + Exonic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917371027 1:174294634-174294656 CTGGTAAATAAAAAGTAAGAAGG + Intronic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
917732056 1:177884450-177884472 CTATAGAAGAAAATGGAAGATGG + Intergenic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
917959353 1:180129936-180129958 CTGTGTAAGAATCAGGGAGAGGG + Intergenic
917986784 1:180327664-180327686 GGGTTTAAGTAAAAGGAAAAAGG - Intronic
918029106 1:180786332-180786354 CTGTCTAGGAATAAGGAAAATGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918233577 1:182557633-182557655 ATAATTAAGAAATAGGAAGATGG - Intronic
918629452 1:186698920-186698942 ATGTTCAAGAAACAGCAAGAAGG + Intergenic
918664554 1:187133794-187133816 CTATTTCAGAAAATTGAAGAGGG + Intergenic
918834914 1:189449828-189449850 CTGACAAAGAAAAGGGAAGAGGG + Intergenic
919214282 1:194532582-194532604 CAGTTTAAAAAAGACGAAGAGGG - Intergenic
919243923 1:194952399-194952421 CTGACAAAGAGAAAGGAAGATGG + Intergenic
919430141 1:197482411-197482433 CTGTTAATGAAAAAAGATGATGG - Intergenic
919527629 1:198673708-198673730 ATGTTTTAGAAAAATAAAGAAGG + Intronic
919605071 1:199671843-199671865 CTATACAAGAGAAAGGAAGAAGG + Intergenic
919919111 1:202157876-202157898 CTGTTCTAGAAAAAGGTAGAAGG - Intronic
920350981 1:205337780-205337802 CTCTTAAAGAGACAGGAAGACGG - Intronic
920855667 1:209659215-209659237 CTGATTTAAAAAAAGAAAGAAGG + Intergenic
921214190 1:212923439-212923461 GTCTTTAAGAAAAGGAAAGAGGG - Intergenic
921295044 1:213693527-213693549 CTCGTTCAGAAAAAGGAAGAGGG + Intergenic
921658357 1:217768380-217768402 CTGTTAAAGAAACATGAAGTTGG - Intronic
921789219 1:219270593-219270615 GTGACAAAGAAAAAGGAAGATGG + Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922660446 1:227425222-227425244 CTGTTTAAAAAAAAACAAGGTGG - Intergenic
922723674 1:227912273-227912295 CTGTCTCAAAAAAGGGAAGAAGG - Intergenic
923089606 1:230729858-230729880 ATCTTTAAGAAACAGGAAGGCGG + Intergenic
923301471 1:232644565-232644587 CAATTTAAAAAAAAGGAAAAAGG + Intergenic
923360239 1:233203986-233204008 GCGTTTAAGAAAAAGGACAAGGG - Intronic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
924501137 1:244639217-244639239 GTGTTTCAGACAAAGGGAGAAGG - Intronic
924567073 1:245207798-245207820 CTCTTTACCAAAAAGGATGATGG - Intronic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063044046 10:2373597-2373619 CTGTTTGGAAAAAAAGAAGAAGG + Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063354478 10:5385291-5385313 CTGGGTAAGATAAAGGAAGTGGG - Intergenic
1063926240 10:10980517-10980539 GTTTTTAAGAAATAGCAAGAAGG - Intergenic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064097859 10:12437109-12437131 CTGTTTAAGAAAAAAAAATCTGG - Intronic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064151251 10:12866995-12867017 CTGATTAAAAAAAAAGAACAAGG + Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064655595 10:17552366-17552388 GTATTTCATAAAAAGGAAGAAGG - Intergenic
1064682312 10:17823051-17823073 CTGTTTAAAAAGAAAGAAGCAGG - Intronic
1064795436 10:19006815-19006837 CTCTTAGACAAAAAGGAAGAAGG + Intergenic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065255086 10:23857951-23857973 CTGGTTAAAAAAAAAAAAGAGGG + Intronic
1065416874 10:25497815-25497837 CTGTTCAACAAAAAAGTAGAAGG - Intronic
1065611905 10:27480081-27480103 CTGCTTAAAGAAAAGGAAGTAGG + Intergenic
1066223247 10:33356555-33356577 CTATGTAAGAAAAAGGAATTAGG - Intergenic
1066317836 10:34266476-34266498 ATTTTTAAGAAAAAGGACTATGG - Intronic
1066784211 10:38984884-38984906 CTGTTTCAGAGAAAGAATGAAGG - Intergenic
1066983840 10:42445596-42445618 CTGTTTCAGAGAAAGAATGAAGG + Intergenic
1067371291 10:45685335-45685357 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067388492 10:45840816-45840838 CTGTTTCAGAGACAGGATGAAGG + Intronic
1067417573 10:46116143-46116165 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067445771 10:46343762-46343784 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067502988 10:46823031-46823053 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067516084 10:46945965-46945987 CTGGTTAAGAACACGGAAGGAGG + Intronic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1067591608 10:47516980-47517002 CTGTTTCAGAGACAGGATGAAGG + Intronic
1067638723 10:48025055-48025077 CTGTTTCAGAGACAGGATGAAGG + Intergenic
1067646164 10:48105845-48105867 CTGGTTAAGAACACGGAAGGAGG - Intergenic
1067874761 10:49995250-49995272 CTGTTTCAGAGACAGGATGAAGG - Intronic
1069006530 10:63323511-63323533 CTGTTTCAAAAAAAGAAAGGGGG + Intronic
1069129380 10:64680172-64680194 CTGTTTAAAAAAGACAAAGAGGG - Intergenic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1069565999 10:69463972-69463994 CTTTATAAGAGAAAGGCAGAGGG + Intronic
1069968247 10:72140190-72140212 CTATTTAAGAAAAAGAAGAAAGG + Intronic
1070135706 10:73691204-73691226 CTGTTTCAGAGACAGGATGAAGG + Intronic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1070427049 10:76298979-76299001 CTAATCAAGAAAATGGAAGAAGG - Intronic
1070484459 10:76916111-76916133 CTGTTTAAGCTAAATGGAGAAGG + Intronic
1070491822 10:76983720-76983742 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1070557768 10:77542382-77542404 CTCTTTAAGAAACAGGGAGGGGG - Intronic
1070777734 10:79119683-79119705 CAACTTAAGAAAAAGGGAGAGGG + Intronic
1070854698 10:79597718-79597740 CTATTTAAGAAAATTGAAGGGGG + Intergenic
1070873318 10:79777652-79777674 ATGTTTGAGAAAACGGAAGGTGG - Intergenic
1070897826 10:80000205-80000227 ATGTTTAAGAAAAAGCAAGGAGG - Intergenic
1071640246 10:87299803-87299825 ATGTTTGAGAAAACGGAAGGTGG - Intergenic
1071654985 10:87438143-87438165 ATGTTTGAGAAAACGGAAGGTGG + Intergenic
1071950076 10:90693172-90693194 TTGACAAAGAAAAAGGAAGATGG + Intergenic
1072173800 10:92895648-92895670 CTGTTCAAACAAAAGGAAGCAGG + Intronic
1072280175 10:93858692-93858714 CATTTTAAGAAAATGGAACATGG - Intergenic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1072670359 10:97425066-97425088 CTGTTTAAAAAAGAAAAAGAAGG + Intronic
1073040310 10:100599683-100599705 CTGGTTAAGAAAAGGTAAGAAGG - Intergenic
1073309106 10:102526861-102526883 GTGTTTAAGGAAAAGAAAGAAGG + Intronic
1073929599 10:108559480-108559502 CTTTTTAAAGAAAAGGATGATGG + Intergenic
1074269546 10:111940106-111940128 CTGTTTAATAAAAAGAAAAAAGG - Intergenic
1074342705 10:112649591-112649613 ATATTTAACAAAAAGGCAGATGG - Intronic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075786751 10:125055146-125055168 ACTTTTAAGAAAAAGCAAGAAGG - Intronic
1075869103 10:125755530-125755552 CTCTTTCAGAAAACAGAAGAGGG - Intronic
1076094265 10:127718308-127718330 CTGTTAAAGAAAAATAAAAATGG + Intergenic
1076153376 10:128183044-128183066 CTCTTTCAGAAAATAGAAGAGGG - Intergenic
1076315813 10:129540718-129540740 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1076497881 10:130909912-130909934 CATATTAAGAAATAGGAAGATGG - Intergenic
1076843207 10:133056743-133056765 CTCTTTAGGAAAAGAGAAGATGG + Intergenic
1076923576 10:133468337-133468359 GTTTTTAAGAAAAAAGAGGAAGG - Intergenic
1077561005 11:3261012-3261034 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1077566902 11:3306842-3306864 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1077810906 11:5635556-5635578 ATGTTTAAAAAAAAGTAACAGGG - Intronic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078862215 11:15259592-15259614 CTGTTGAAGAAACAGGATGAGGG + Intergenic
1079339428 11:19599774-19599796 CTGTTTGAGAAACAGCATGAGGG + Intronic
1079487486 11:20950614-20950636 CTGTTTCAGAGAAGGGGAGAAGG - Intronic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1080124954 11:28722119-28722141 GTGTTCAAGACAAAGTAAGAAGG - Intergenic
1080128862 11:28769838-28769860 GAGTTTAAGAAAAAGGAACTAGG + Intergenic
1080257673 11:30309460-30309482 CTGGCTGAGAAAAAGAAAGAAGG - Intergenic
1080311559 11:30898972-30898994 GTGTTAAAGAGAATGGAAGAAGG + Intronic
1080478334 11:32619666-32619688 CTGTTGAAGAAAGAAGGAGAAGG + Intronic
1080849308 11:36054644-36054666 CTGCTTAAAAAGAATGAAGATGG + Intronic
1080955684 11:37092387-37092409 CAAATTATGAAAAAGGAAGAGGG + Intergenic
1081225288 11:40513823-40513845 CTGAGTAAGAAAAAAGAAAATGG - Intronic
1081834363 11:46142109-46142131 CTGTATAAAAAAGAAGAAGAAGG + Intergenic
1081890166 11:46534673-46534695 GTCTCTCAGAAAAAGGAAGAGGG - Intronic
1081975665 11:47233089-47233111 CAGTTTGAGAAAGAGAAAGAAGG - Intronic
1082985265 11:59163637-59163659 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
1083059924 11:59859117-59859139 CTGTCTGAGAAAAAAGAAAATGG - Exonic
1085079540 11:73622766-73622788 CTGCTTAAAAAAAAAAAAGAAGG + Intergenic
1085484362 11:76849369-76849391 TTGGGTAAGACAAAGGAAGAAGG - Intergenic
1086008694 11:82071885-82071907 GTGTTTAATAAACAGGAAGTGGG - Intergenic
1086426294 11:86686791-86686813 CTGCTTAAGCAAAAGCAAGGAGG - Intergenic
1086775694 11:90830129-90830151 TTTTTTAAGAAAAAGGCAGAGGG + Intergenic
1086824704 11:91482100-91482122 CTGTTTTAGAAAAAACAACAAGG - Intergenic
1087574106 11:99968612-99968634 CTGTTTATCATAAAGGAATATGG + Intronic
1088262966 11:107961502-107961524 CAGTTTAGGAAAAAGAAACAAGG - Intronic
1088422588 11:109665884-109665906 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
1088477805 11:110261801-110261823 CTATTTAAAAAGAAGGAAGGTGG - Intronic
1088489707 11:110375082-110375104 CTGTTTAAGACAGAGGAAATTGG + Intergenic
1088541830 11:110921091-110921113 CTGTTTAAGAAAAATCTAGTTGG - Intergenic
1088799843 11:113295676-113295698 CTGTTAAAGAGAAGGGAAGATGG - Intergenic
1088864313 11:113832601-113832623 CTTTTTAAGAAAAAGGCCCAAGG + Intronic
1088925719 11:114299555-114299577 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1090174121 11:124632664-124632686 CTGTCTAAGAACTAGGAAGTGGG - Exonic
1090749993 11:129738134-129738156 AGGTTTCAAAAAAAGGAAGACGG - Intergenic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1091162960 11:133442603-133442625 ATCTTTAATAAAAAGGAAGTAGG + Intronic
1091424709 12:377010-377032 TTGTTTTAGAAAAGGGAGGAAGG - Intronic
1091575260 12:1727853-1727875 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1091578419 12:1762054-1762076 CTGTTTAAGAAACTGAAATAAGG - Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092268435 12:7001776-7001798 ATGTTAGTGAAAAAGGAAGAGGG - Intronic
1092370625 12:7914110-7914132 TTGTTTAAAAAAAAAAAAGAAGG - Intergenic
1092441918 12:8512003-8512025 GTGCCTAAGAGAAAGGAAGAGGG + Intronic
1092497009 12:9006438-9006460 ATGTTAAAGGAAAAGAAAGAAGG + Intronic
1092642524 12:10531309-10531331 GTGTTTAATAAAAAATAAGATGG + Intergenic
1093321058 12:17715986-17716008 CACTTTCAGAAAAAGGAAGAAGG - Intergenic
1093840357 12:23891603-23891625 CAATTTAAGAAAAAAAAAGAAGG - Intronic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094443580 12:30506037-30506059 CTGTCTAAAAAAGAGGAAAATGG - Intergenic
1094479215 12:30868045-30868067 CTGTTTCAGAAAATAGAAAAAGG - Intergenic
1094501201 12:31022562-31022584 CTATTACAGAAAAAGGAAAAGGG + Intergenic
1094570516 12:31637466-31637488 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
1095173145 12:39058431-39058453 CCTTTTAAGAAACAGGAAAAAGG - Intergenic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1095803933 12:46297317-46297339 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1095877420 12:47097310-47097332 AGCTGTAAGAAAAAGGAAGAGGG - Intronic
1095949185 12:47772670-47772692 CTGTTTAAAAAAAAAAAAGTAGG + Intronic
1096610639 12:52798978-52799000 TGGTGGAAGAAAAAGGAAGAAGG + Intergenic
1097255362 12:57669708-57669730 TTTTTTAATAAAAAAGAAGATGG - Intergenic
1097795808 12:63860824-63860846 CTCTTTAAAAAAAAAAAAGAGGG - Intronic
1098219009 12:68248700-68248722 TTTTTTAACCAAAAGGAAGATGG - Exonic
1098683212 12:73384359-73384381 ATGTTAAATAAAATGGAAGAGGG - Intergenic
1098725282 12:73957004-73957026 TGGTTTCAAAAAAAGGAAGAAGG - Intergenic
1098935119 12:76469993-76470015 CTATTTAAGGAAAAGAATGAGGG - Intronic
1099451152 12:82808246-82808268 ATGTTTCAGAAAAAGAAATATGG + Intronic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1099678873 12:85798040-85798062 CTGCTTAAAACAAAGGAAGGAGG - Intergenic
1099816859 12:87660225-87660247 CTGTTTTAAAAAGAGAAAGATGG - Intergenic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100435736 12:94569933-94569955 GTGTATAACAAAGAGGAAGATGG - Exonic
1100480910 12:94978026-94978048 CTGTTCAAGGAAAAGCAAGAAGG + Intronic
1100879845 12:99004574-99004596 CTGTTTGAGAAAAATGAGAAAGG + Intronic
1100939766 12:99713396-99713418 CTGTTAAACAAAAAGGAACTAGG - Intronic
1101047634 12:100826613-100826635 CAGTGTAAGATAAAGGAACAGGG - Intronic
1101082188 12:101198736-101198758 CTATTTCAGAAAATGGAGGAGGG + Intronic
1101233998 12:102769791-102769813 CTGTTCATGACAAAGGCAGATGG + Intergenic
1101664827 12:106802907-106802929 CAGTTTAAAAAAAATGAACAGGG + Intronic
1101715608 12:107309380-107309402 CTGTTTAAAAAAAAAAAAAATGG - Intergenic
1101880312 12:108621892-108621914 CTGTTAAAGAAAAAAAAAAATGG - Intergenic
1102381661 12:112472122-112472144 TTCTTTAAAAAAAAGGCAGAAGG - Intronic
1102428703 12:112864775-112864797 CAGTTTAAGGAAAGGGTAGAGGG - Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1102840433 12:116114098-116114120 ATGTTTAAAAAAAAGGAAAAGGG - Intronic
1103113785 12:118307471-118307493 CTGTTTAAAACAAAGGCAGCAGG - Intronic
1103817138 12:123667562-123667584 CACTTTCATAAAAAGGAAGATGG - Intergenic
1103859873 12:124003694-124003716 CTGATTAAGAAAATAGAAGCAGG - Intronic
1103992992 12:124811755-124811777 CTCTTCACGACAAAGGAAGAAGG + Intronic
1104382525 12:128319873-128319895 CTGTTCAAGAAGATGCAAGATGG - Intronic
1104426659 12:128683407-128683429 CTGTTCTAGAAAGAGAAAGAAGG - Intronic
1104751436 12:131242456-131242478 GTTATTAAGAAAAAGCAAGAAGG + Intergenic
1104882626 12:132083197-132083219 CTGTTTAAGAAAATCAAAGCTGG + Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106944862 13:34815907-34815929 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1107117478 13:36762532-36762554 CTGACAAAGAAAAGGGAAGATGG + Intergenic
1107492637 13:40896033-40896055 CTTTTTAAAAAAAAGGTAAAGGG + Intergenic
1107503121 13:41001415-41001437 CTTTTTAAAAAAAAGATAGATGG - Intronic
1107743085 13:43474779-43474801 CTTTTTAAGAAAAATTAATATGG + Intronic
1107784793 13:43944032-43944054 ATGTTCCAGAAAAAGAAAGAAGG + Intergenic
1107860176 13:44653118-44653140 CTCTTGAAGAAAAATGAAGCAGG - Intergenic
1107945305 13:45412718-45412740 CTTATTATGGAAAAGGAAGATGG - Intronic
1108153553 13:47562105-47562127 CTATTAAAGAAAAAAGAAGATGG + Intergenic
1108228399 13:48314225-48314247 CTGTTTTAAAAAAAGGCAGCTGG + Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108753907 13:53476769-53476791 CTCTCGGAGAAAAAGGAAGATGG - Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1108972582 13:56395503-56395525 CTGTTTGGAAAAAAGAAAGAAGG + Intergenic
1109291812 13:60485157-60485179 CTCATTAATAAAAAGGAAAATGG - Intronic
1109996397 13:70133100-70133122 CTGTATCAGAAATAGGATGAAGG + Intergenic
1110066893 13:71119487-71119509 CTGTTTAATTAAAAGAAAGAAGG - Intergenic
1110112970 13:71773970-71773992 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1110214255 13:73009041-73009063 TGGTTGAAGAGAAAGGAAGAGGG - Intronic
1110407835 13:75170346-75170368 GTTTTTAAGAAAAAGAAGGATGG + Intergenic
1110599848 13:77360481-77360503 GTGATGAAGAAACAGGAAGAAGG + Intergenic
1111171433 13:84531646-84531668 TTGATTAAGAAAAAAGAAGAGGG + Intergenic
1111317247 13:86578888-86578910 CTATTTTGGAAAAAGAAAGATGG - Intergenic
1111484538 13:88879581-88879603 CTGTCTAAAAAAAAGAAAAAAGG - Intergenic
1111577531 13:90175930-90175952 CTGGCAAAGAAAAGGGAAGATGG - Intergenic
1111742926 13:92227090-92227112 CTGTTTCAGAAAGGGGCAGAAGG - Intronic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1112000756 13:95207596-95207618 CTGTTTAAGAACATGGTAAATGG + Intronic
1112306144 13:98276015-98276037 ATGCCTCAGAAAAAGGAAGAAGG - Intronic
1112341514 13:98556466-98556488 TAGTTTAAGCAAAAAGAAGAAGG - Intronic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113243047 13:108361355-108361377 CCATTTAAGAAAAAGCAAGCAGG + Intergenic
1113506102 13:110817069-110817091 CTGTTTAAGGAAAAAGAATAAGG + Intergenic
1113542293 13:111118245-111118267 CTGTTTCAGAGTTAGGAAGAGGG + Intronic
1114196884 14:20486017-20486039 GTGACTAAGAAAAGGGAAGATGG - Intergenic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1115036174 14:28859076-28859098 CTTTTTTAACAAAAGGAAGAGGG - Intergenic
1116115078 14:40637657-40637679 TTGTTTAAAAAAAAGGCAAATGG - Intergenic
1116980172 14:51160751-51160773 TTATTTAAGAAAGAGGAAGTAGG - Intergenic
1117226756 14:53669102-53669124 CTGTTTAAGAAATAGTACGTGGG + Intergenic
1117498235 14:56326983-56327005 CAGCTGAAGAACAAGGAAGAAGG - Intergenic
1117572532 14:57062100-57062122 CTGTTTTGGGAAAAGGAAGGGGG - Intergenic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118452836 14:65919494-65919516 CAGTTTAAGAAAAGGGACTAGGG - Intergenic
1119109206 14:71955898-71955920 CCCCATAAGAAAAAGGAAGATGG + Intronic
1119836812 14:77757842-77757864 TTGTTTAAGAAAAGATAAGAAGG - Intronic
1120035993 14:79698996-79699018 CTGCTCAAGGAAAAGGAAAAAGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120113835 14:80590508-80590530 CTGTTTAGGAATAAAGATGAAGG + Intronic
1120290741 14:82567301-82567323 CAGTTAAAGATAAATGAAGACGG - Intergenic
1120404073 14:84072145-84072167 TTGTTTTACAAAAAGGAAAATGG - Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1120814970 14:88846462-88846484 TTGTTTAAGGAACAGTAAGAAGG + Intronic
1120834098 14:89025469-89025491 CTGTTCAAGAGAAAGAAAAAAGG - Intergenic
1120954484 14:90069333-90069355 CTGTTTAATAAAAATGAATAGGG - Intronic
1121825196 14:97004511-97004533 CTGTTTATGAACCAGGAAGTAGG + Intergenic
1121962138 14:98271082-98271104 TTGTTTAACTAAAAGGAACATGG + Intergenic
1122017786 14:98810846-98810868 CTTTTCAAGGAAAATGAAGAAGG + Intergenic
1122134285 14:99623957-99623979 TTATTGAAGGAAAAGGAAGATGG + Intergenic
1122345072 14:101053601-101053623 ATCTTTAAGAAAAAGCAAGAAGG + Intergenic
1122405050 14:101495821-101495843 ATGTTAAAGAAAAAGGTAAAAGG + Intergenic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1123453032 15:20385359-20385381 CTGGCTTAGAAAATGGAAGAGGG + Intergenic
1123771482 15:23534202-23534224 CTGACAAAGAGAAAGGAAGATGG - Intergenic
1124633173 15:31348863-31348885 CTGTCTACGAACCAGGAAGAGGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125143809 15:36442009-36442031 CTGTTTAAGAATAAGTATGCAGG - Intergenic
1125452667 15:39825195-39825217 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1126052096 15:44695386-44695408 CTGACAAAGAAAAGGGAAGATGG - Intronic
1126075586 15:44905993-44906015 CTGGCAAAGAAAAAGAAAGAAGG - Intergenic
1126221880 15:46223587-46223609 TTGTTAAAGAAAAAGGGACAGGG - Intergenic
1126310444 15:47310010-47310032 CTGTACAAGAAAAGGGAACATGG + Intronic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1126446383 15:48749674-48749696 CTGTTAAAAAAAAATGAAGGTGG + Intronic
1126502750 15:49364688-49364710 CTGTTTAAGACCATGCAAGAAGG - Intronic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1126913596 15:53440937-53440959 TTTTTTAAGAAAAAAAAAGATGG + Intergenic
1127706333 15:61550582-61550604 GGGTTTAAGAAAAAGAATGAGGG - Intergenic
1128040554 15:64568999-64569021 ATGTTTGAGAAAAAGAAAGAAGG - Intronic
1128198274 15:65780074-65780096 CTGTTTACAATAATGGAAGAAGG + Intronic
1128289102 15:66463204-66463226 CTGATTCAGACAAATGAAGAAGG - Intronic
1128848068 15:70919027-70919049 CTGTTAAAGAAAATAGGAGAAGG - Intronic
1129052450 15:72793799-72793821 CTGTGTAAGAAAAAAAAAAATGG - Intergenic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130138332 15:81200073-81200095 TTGTTTTAGAAAAAGGAAGTTGG - Intronic
1130161554 15:81406145-81406167 TTGTTTAAAAAAAAAGAAAAAGG + Intergenic
1130217751 15:81988189-81988211 CTGTTTCAGAAAGAGCAGGAAGG + Intergenic
1130372379 15:83296030-83296052 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1130689571 15:86069946-86069968 CTGTCTATGAACCAGGAAGAGGG - Intergenic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1130794099 15:87190187-87190209 ATTTCTAAGAAAGAGGAAGATGG - Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1130922012 15:88355238-88355260 CTGTTTCAGAAACAGGAATGGGG - Intergenic
1131287047 15:91068754-91068776 CTGTCTCAGAAAAAAAAAGAAGG - Intergenic
1132225325 15:100136310-100136332 CAGCTTAAGAAAAAAGAAAACGG + Intronic
1132320978 15:100925056-100925078 TAATTTAAAAAAAAGGAAGAAGG + Intronic
1132532258 16:458274-458296 CTGTTTCAGGAAAAGGATGGGGG - Intronic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1134194308 16:12147254-12147276 CTGTTAAGGGAAAAGGGAGAAGG + Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134565256 16:15246467-15246489 CTGTCTATGAACTAGGAAGAAGG - Intergenic
1134634215 16:15779830-15779852 CTGTTGAGGAAACAGGAAAAGGG - Intronic
1134737240 16:16510231-16510253 CTGTCTATGAACTAGGAAGAAGG + Intergenic
1134747524 16:16599610-16599632 CTGTCTCAGAAAAAAGAAAATGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134930278 16:18201929-18201951 CTGTCTATGAACTAGGAAGAAGG - Intergenic
1134997946 16:18754047-18754069 CTGTCTCAGAAAAAAGAAAATGG + Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135236688 16:20763429-20763451 GTGTTTGAGAAAAAGCAAGGAGG + Intronic
1135272682 16:21082942-21082964 CTGTTAAAAAAAAAGCAAGATGG - Intronic
1135460200 16:22635682-22635704 CTGCTAGAGAAAAAGGGAGAGGG - Intergenic
1135563633 16:23495200-23495222 AATTTTAAGAAAAAGGAAAAGGG - Intronic
1137382108 16:48009133-48009155 CTGACAAAGAAAAAGGAAGCAGG + Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1137984611 16:53097403-53097425 CTGTGAAAGAAAGAGAAAGAAGG - Intronic
1138280385 16:55768414-55768436 CTTTGTAAGACAAAGGAAGTGGG + Intergenic
1138349897 16:56340901-56340923 CTTGTTAAGAAACAGGATGATGG - Exonic
1138622844 16:58225465-58225487 CTGTTTCAGAAAAAAAAAAAAGG + Intergenic
1138707327 16:58930015-58930037 TTTTTTAAGTAAAAGGGAGAAGG - Intergenic
1139025462 16:62811995-62812017 TTATTTAAGAAAAAGAAAAAAGG + Intergenic
1139361213 16:66401382-66401404 CTATTTTTGAAAAAGGAAAAAGG + Intronic
1139903837 16:70348937-70348959 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1140551417 16:75870208-75870230 ATGTTTGAGAAAAAGCAAGGAGG + Intergenic
1140553940 16:75898281-75898303 ATTTTTAAGAAAAAGGAAGATGG - Intergenic
1140563166 16:76008254-76008276 GTGTTTGAGAAACAGAAAGAAGG - Intergenic
1140917399 16:79506553-79506575 CTGGTAGATAAAAAGGAAGACGG + Intergenic
1140963302 16:79938644-79938666 CTGTCAAATAAAAAGGAAGCTGG - Intergenic
1141024348 16:80530528-80530550 CTCTTTCAGAAAACAGAAGAAGG - Intergenic
1141115868 16:81308872-81308894 TTGTTCAAGAAAGAGCAAGAAGG + Intergenic
1141514690 16:84535947-84535969 CTGACAAAGACAAAGGAAGATGG - Intronic
1142017747 16:87760043-87760065 ATGATTAAGAAATAGGAAGTTGG + Intronic
1142191715 16:88721199-88721221 ACGTTTTAGAAGAAGGAAGAAGG - Exonic
1142829117 17:2534360-2534382 CTGGTTAAGAAAAAGACAAAAGG + Intergenic
1142972453 17:3621953-3621975 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
1143224093 17:5285840-5285862 GTCTTTAAGAAGAATGAAGAAGG - Intronic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1144354988 17:14436722-14436744 TTTTGGAAGAAAAAGGAAGATGG + Intergenic
1144461245 17:15460217-15460239 CTGGTTAACAAACTGGAAGAAGG - Intronic
1145774467 17:27518374-27518396 TTCTTAAAGAAAAAGGCAGAAGG + Intronic
1145985340 17:29042400-29042422 CTCTTTGAGAAAAAGAAAAAAGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146087208 17:29840588-29840610 ATGGTGAAGAAAATGGAAGATGG + Intronic
1146128440 17:30248819-30248841 CTGTTAAAGGAAAAAAAAGAGGG - Exonic
1146191431 17:30770935-30770957 CTTTTTTAAAAAAAGAAAGAAGG + Intronic
1146336591 17:31977588-31977610 CTTTTTTAAAAAAAGAAAGAAGG + Intronic
1147354287 17:39881362-39881384 GTCTTTATGAAACAGGAAGAAGG + Intergenic
1147601113 17:41746143-41746165 CTGTCTCAAAAAAAAGAAGATGG - Intergenic
1147619600 17:41856714-41856736 CTCTTTAAAAAAAAGGCACATGG + Intronic
1147801180 17:43089671-43089693 TTCTTTAAAAAAAAGAAAGATGG - Intronic
1147908454 17:43839322-43839344 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1149109999 17:53017563-53017585 ATGTGTAAGAAAATGGGAGAAGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149911665 17:60572484-60572506 TTGTTTGAGAAACAGAAAGAAGG - Intronic
1150189405 17:63222114-63222136 CTGTCTACGAAACAGGAAGTTGG - Intronic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1150515069 17:65799689-65799711 CTGTTTCAGAAAGAGGCACAAGG - Intronic
1150571356 17:66389822-66389844 CTTTTTAAGAAAGAGATAGAAGG + Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151151579 17:72092433-72092455 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1151194068 17:72419666-72419688 CTTTTTAAAAAAATTGAAGATGG - Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151908655 17:77066621-77066643 CTGACTTAGAAAGAGGAAGAAGG - Intergenic
1151970016 17:77452833-77452855 CCTTTTCAGGAAAAGGAAGAAGG + Intronic
1152176077 17:78788462-78788484 TTGTTTTAGAAAAAGGAACCAGG - Intronic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153882884 18:9435940-9435962 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1154311938 18:13273714-13273736 CTCTCTAAGGTAAAGGAAGATGG - Intronic
1155448907 18:25943103-25943125 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1155710137 18:28866860-28866882 ATATTTAAAAAAAAGGTAGAGGG + Intergenic
1156000595 18:32379968-32379990 TTTTTTAAAATAAAGGAAGAAGG + Intronic
1156017983 18:32567804-32567826 CTGTTTAAAAAAAAGGGGGGGGG - Intergenic
1156138924 18:34081016-34081038 CTTTTTAAGAAATTAGAAGATGG + Intronic
1156172376 18:34501496-34501518 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1156218801 18:35030129-35030151 ATGGTTAAGAAAAAGGGAGGGGG - Intronic
1156266489 18:35493262-35493284 CTGTTAAAGTGAAAGGAATAAGG - Intronic
1156428074 18:37037798-37037820 ATGGTTGAGAAAAGGGAAGATGG + Intronic
1156526271 18:37770237-37770259 CTGTTAAATAAAAAGAAAGCAGG - Intergenic
1156689429 18:39688958-39688980 CTCTAGAAGAAAAAGAAAGAAGG + Intergenic
1156711427 18:39951159-39951181 TTGTTTTAGAAAAAGAAAGAGGG + Intergenic
1156740970 18:40327321-40327343 TTGTGTAAAATAAAGGAAGAAGG - Intergenic
1156867644 18:41906673-41906695 CTTATAAAGAAAAACGAAGATGG - Intergenic
1157308172 18:46531992-46532014 CTGGTGACAAAAAAGGAAGATGG + Intronic
1157331570 18:46707838-46707860 CTGTTTATGAACCAGGAAGTAGG + Intronic
1157422337 18:47557484-47557506 CTGTTTTAAAAAAATGAATAGGG - Intergenic
1157772539 18:50361969-50361991 CTGTTTAAAGAAAAGGAGGCTGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158138920 18:54236132-54236154 CTGTTTAAGACAAAGTGAGAAGG - Intergenic
1158430020 18:57376815-57376837 CAGTTTCAGAAACAGGAAGATGG + Intergenic
1158489194 18:57894790-57894812 CTTTTTAAGAGAAAAGCAGAGGG + Intergenic
1158992953 18:62888982-62889004 CTGTTTCAGAGAAAGATAGAGGG - Intronic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160253432 18:77224814-77224836 CAGTTTAATAAAATGGAATACGG - Intergenic
1160702673 19:515730-515752 CTGTCTCAAAAAAAGAAAGAGGG + Intronic
1161896477 19:7085468-7085490 CTTCTTAAGATAAAGGATGAGGG + Intronic
1161945411 19:7433160-7433182 CTCTTTAAAAAAAAAAAAGAAGG + Intronic
1161961089 19:7523464-7523486 CTGTTTACGACAAAGCCAGAGGG - Intronic
1162113522 19:8414272-8414294 CTGTCTAAAAAAAAAAAAGACGG - Intronic
1162115536 19:8427052-8427074 CTGTCTCAAAAAAAAGAAGAAGG - Intronic
1162341331 19:10093105-10093127 CTGTTCAAGTAAAGGGCAGAGGG - Exonic
1162456381 19:10787464-10787486 CTGTTTAAAAAAAAGAAAAAAGG + Intronic
1162512601 19:11128613-11128635 CTTTTTAAGAAATAGGAAGTGGG - Intronic
1162715895 19:12633141-12633163 ATGTTTAATAAAAAGGAAAATGG - Intronic
1162906864 19:13829288-13829310 TTGTTTAACAAAAAGAAAGAGGG + Intronic
1162944972 19:14037555-14037577 GTGTTTAACAAATAGTAAGAAGG - Intronic
1164505493 19:28857466-28857488 TTGTTTCAGACAAAGGAACAAGG - Intergenic
1164620088 19:29690282-29690304 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1164728545 19:30483562-30483584 TTGTTTAAGAAGCAGAAAGAGGG - Intronic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1165128641 19:33618681-33618703 CTATTAAAAAAAAAAGAAGAAGG - Intergenic
1165332403 19:35147986-35148008 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1166613150 19:44218110-44218132 ATGTGTATGAAAAAGGAACATGG - Intronic
1167075523 19:47246345-47246367 CTGTCTAAAAAAAAAGAAAAAGG - Intergenic
1167472941 19:49685540-49685562 CTGTTTAAAAAAAAAAAATACGG + Intronic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168150403 19:54444384-54444406 CTGATTAAAAAATAGGAAAAGGG + Intergenic
1202700580 1_KI270712v1_random:160895-160917 TGGTTTGAGAAACAGGAAGAAGG + Intergenic
925317604 2:2937829-2937851 CTGTTTCAAAAAAAGGGAGGTGG - Intergenic
925629294 2:5872821-5872843 CAGTTTCAGAAATAAGAAGATGG - Intergenic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
925951610 2:8918548-8918570 TTGTTTAATAAAAAGAAAAAAGG + Intronic
925998051 2:9307832-9307854 CTGTTTAATTAAAAAGGAGAAGG - Intronic
926482279 2:13414065-13414087 CTGGCTTAGAAAATGGAAGAGGG - Intergenic
926606052 2:14899426-14899448 CTGGTTAAATAAAATGAAGAAGG + Intergenic
927489750 2:23513247-23513269 TTGTTTAAGAAAAAAGAAATTGG - Intronic
927517976 2:23682975-23682997 CTGCTGAAGACCAAGGAAGACGG - Intronic
928899857 2:36305239-36305261 CTTTTTAAGAAAAATGATCAAGG - Intergenic
929070547 2:38025985-38026007 GTTTTTAAGGAAAATGAAGAAGG - Intronic
929621436 2:43358808-43358830 CTCTTTTAGAAAAATAAAGATGG + Intronic
929717647 2:44329239-44329261 TTGTTTAAGAAAAAGAATTATGG + Intronic
930291845 2:49504079-49504101 GTGTTTAAGAAAAATTAAAATGG - Intergenic
930491169 2:52074503-52074525 CTGCATTAGAAACAGGAAGAAGG + Intergenic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
931034170 2:58218401-58218423 CTGATTAAGAAAAATTAAAAAGG + Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931184352 2:59935288-59935310 CCTTTAAAGAAAAAGGAACATGG - Intergenic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932381255 2:71285399-71285421 CTGTTTAAAAAAAAGAAAATGGG - Intronic
932394658 2:71433453-71433475 CTGTTCAAGGAAAAGGAATAAGG - Intronic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933117276 2:78489969-78489991 AAGTTTAAAAAAAAGGAAAATGG + Intergenic
933241187 2:79922111-79922133 GTGATTAAGAAAACGGAAAAAGG - Intronic
933569827 2:83996619-83996641 ATGTTAAAAAAAAATGAAGAAGG - Intergenic
933693184 2:85195549-85195571 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
933856321 2:86418058-86418080 TTCCTTATGAAAAAGGAAGACGG - Intergenic
933906773 2:86901925-86901947 CAGTTTAAGAAGTATGAAGAGGG + Intergenic
934024703 2:87991709-87991731 CAGTTTAAGAAGTATGAAGAGGG - Intergenic
934171507 2:89544367-89544389 TGGTTTGAGAAACAGGAAGAAGG + Intergenic
934281815 2:91618685-91618707 TGGTTTGAGAAACAGGAAGAAGG + Intergenic
934748741 2:96777869-96777891 CTGTTTCAGAAAAAAAAAAAAGG - Intronic
935456547 2:103275540-103275562 CTTTTTCAGAGAAATGAAGAAGG - Intergenic
935463650 2:103368765-103368787 CTGTCTATGAACCAGGAAGAGGG - Intergenic
935547046 2:104411358-104411380 CTTTTAAAGAAAAAGAAAAATGG + Intergenic
935818171 2:106867380-106867402 AAACTTAAGAAAAAGGAAGAGGG - Intronic
935850823 2:107216985-107217007 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
935886302 2:107623426-107623448 GTTTTGAAGATAAAGGAAGAGGG + Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
935959920 2:108414664-108414686 ATGTTTGAGGAAAAGCAAGAAGG + Intergenic
935959928 2:108414751-108414773 ATGTTTGAGAAACAGCAAGAAGG - Intergenic
936365391 2:111849746-111849768 CAGTTTAAGAAGTATGAAGAGGG - Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
936690124 2:114877235-114877257 CTGATTAAGAAAGAAGAAAAAGG + Intronic
936992153 2:118377565-118377587 GTGATTAAGACAGAGGAAGAGGG - Intergenic
937756617 2:125547048-125547070 CTGTTTCAAAGAAAGAAAGAAGG - Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938130461 2:128710994-128711016 CTGGTTGAGAAAGAGGAAGGGGG + Intergenic
938749222 2:134312842-134312864 CGTTTTAGAAAAAAGGAAGATGG - Intronic
938756103 2:134380462-134380484 GTGGTTAAGAAAAAGGGACATGG + Intronic
938757234 2:134391984-134392006 GTCTATAAGAAAAAGGGAGAAGG - Intronic
939186890 2:138871735-138871757 CTGTTTATCAAAATGGAACAAGG + Intergenic
939282515 2:140082834-140082856 CTGTTGAAGAGAAAGAAATATGG - Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939816454 2:146902867-146902889 TTTTTTAAAAAAAAGGGAGATGG - Intergenic
940003051 2:148986109-148986131 CTGATAACGATAAAGGAAGAAGG + Intronic
940543667 2:155055028-155055050 TTGACAAAGAAAAAGGAAGATGG + Intergenic
940626519 2:156182079-156182101 CTGTTTCTGAACAAGGAAAATGG + Intergenic
941466980 2:165839536-165839558 CATTTGCAGAAAAAGGAAGAAGG + Intergenic
941484581 2:166064013-166064035 GTTTTAAAGAAAAAGCAAGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942377412 2:175352029-175352051 CTCTATAAGAGAAAGGCAGAGGG - Intergenic
942549529 2:177100562-177100584 CTGTTTCAAAAAAAAAAAGAGGG - Intergenic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
943080755 2:183256225-183256247 CTTTTTAAGAAAAGTGCAGAAGG - Intergenic
943236059 2:185321444-185321466 CTGGTTAAAAAAAAGTTAGATGG - Intergenic
943601707 2:189929378-189929400 ATGTTTATGAAAAATGAAGGTGG - Intronic
943714628 2:191137038-191137060 CTGATTAAAAAAATTGAAGAGGG + Intronic
943730181 2:191294341-191294363 GTATTCAAGAAAAAGGGAGAAGG + Intronic
943896451 2:193368307-193368329 CTGTTCAAGATAAAGTAACAAGG - Intergenic
944022312 2:195120898-195120920 AAATTTAAGAAAAAGGAACATGG + Intergenic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
946345989 2:219110800-219110822 ATGTTCAAGAAACAGGAAGGAGG + Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
946938676 2:224748447-224748469 ATTTCTAAGAAAAAGGAAGTCGG + Intergenic
947018035 2:225643319-225643341 ATGTTTAAGCACAAGGAACATGG - Intronic
947256648 2:228173160-228173182 TTATTAAATAAAAAGGAAGAGGG - Intronic
947547426 2:231020253-231020275 CTTTTTAGGGGAAAGGAAGATGG - Intronic
947678775 2:232010519-232010541 TTGATTAAGAAAAAAAAAGAGGG - Intronic
948348329 2:237317971-237317993 ATGTTTGAGAAACAGCAAGATGG - Intergenic
948740817 2:240044628-240044650 TTATTTAGGAAAAAGGCAGAGGG + Intergenic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168778261 20:466349-466371 CTGTTTCAGATAAAGAAAAACGG - Intergenic
1169306131 20:4492086-4492108 CTTTTGAAGAAAGAGGAAGGAGG + Intergenic
1169326768 20:4682973-4682995 CTATCTAAAAAAAAAGAAGAAGG + Intergenic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1169524973 20:6414464-6414486 ATTTCTAAGAAAAGGGAAGAAGG + Intergenic
1169612028 20:7392304-7392326 CAATTTTAGAAATAGGAAGAAGG - Intergenic
1169634395 20:7672183-7672205 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1170034090 20:11971955-11971977 CTGATTAAGAAAATAGAATATGG - Intergenic
1170298406 20:14854713-14854735 CTCTTTAAGAAAAAGACAAATGG + Intronic
1170985008 20:21249648-21249670 CTTTTTAAGAAGAAAGAAAAAGG - Intergenic
1171000687 20:21412836-21412858 CTGTCTAAAAAAAAGGAGGGAGG - Intergenic
1173305908 20:41849241-41849263 TTGATTAAGAAAAAGAAATAAGG - Intergenic
1174008966 20:47433557-47433579 ATTTTTAAAAAAAAGGAAAAAGG + Intergenic
1174090845 20:48046029-48046051 CTGGTTAAGAAACACAAAGAAGG - Intergenic
1174462602 20:50693410-50693432 TTTTTTAAAAAGAAGGAAGATGG - Intergenic
1174586510 20:51612787-51612809 CCTTTTATGAAAAAGCAAGATGG + Intronic
1174701298 20:52611646-52611668 CTGTATAAGAAAGAAGGAGATGG - Intergenic
1175277909 20:57784362-57784384 ATATTTAAGAAAGGGGAAGAGGG - Intergenic
1175422437 20:58842983-58843005 CTGTTTAAAAAACAGCAAGATGG - Intronic
1176677848 21:9797306-9797328 CTTTTGAAGAAAATGGAAGTAGG - Intergenic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1177280862 21:18981312-18981334 CTCTTCAAAAAAAAGGAACATGG + Intergenic
1177356807 21:20019015-20019037 CTGTTTAATAGATAGGTAGATGG - Intergenic
1177400256 21:20594387-20594409 TTGTTAAAGAAAAAATAAGAGGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177661386 21:24087862-24087884 CAGTTTAAGAAAGACAAAGAGGG + Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178484977 21:33013398-33013420 CTTTATAAGAGAAAGGCAGAGGG - Intergenic
1178819755 21:35964220-35964242 CTATCAAAGAAAAGGGAAGATGG + Intronic
1178961644 21:37072006-37072028 CTGATTAGGAAAGAGTAAGAGGG - Intronic
1179132143 21:38647302-38647324 CTGTTTAGGAAAAAAGACGGTGG - Intronic
1180124461 21:45779429-45779451 CGAGTTAAGGAAAAGGAAGAGGG - Intronic
1180918032 22:19503160-19503182 CTGTTTTAAAAAAAGAAAGCAGG + Intronic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182757267 22:32690167-32690189 CTGTCTCAAAAAAAGGAAAAAGG + Intronic
1182877391 22:33704189-33704211 CTGTATAAAACAAAGGAATATGG + Intronic
1183245898 22:36693139-36693161 CTGTCTAAAAAAAAGAAAAAAGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183881545 22:40836152-40836174 TTGTTTAAGGAAAAAGTAGACGG + Intronic
1184306905 22:43609755-43609777 CTCTTGAAGAACAAGGTAGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1185132124 22:49045186-49045208 CTCGACAAGAAAAAGGAAGAGGG - Intergenic
1185200069 22:49496427-49496449 ATGTTAAAGAAAAATAAAGATGG - Intronic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
949451933 3:4195502-4195524 CCGTTTAACAAAAAGGAAACTGG + Intronic
949642083 3:6047984-6048006 CTGGCAAAGAGAAAGGAAGAGGG - Intergenic
950041544 3:9922870-9922892 GTGTTTAAGAAATAGTAAGGAGG + Intronic
950220238 3:11189943-11189965 CTGTTTCAAAAAAAGAAAAATGG + Intronic
950642220 3:14355713-14355735 CTTTTGAAGAAAGAGGAAGGAGG - Intergenic
950932504 3:16804587-16804609 CTGATTCAGAGTAAGGAAGAAGG + Intronic
951492047 3:23281635-23281657 CTGTTTAAAAAAGAAGGAGAAGG + Intronic
951521440 3:23614604-23614626 TTTATTAAAAAAAAGGAAGAAGG - Intergenic
951535810 3:23739615-23739637 CTGTTTAAAAAAAAAAAAAAGGG + Intergenic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952348360 3:32509884-32509906 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
952997627 3:38900344-38900366 CTGTTGAAGATAAAGCAAAATGG + Intronic
953094807 3:39765067-39765089 TTGTTTAAGAAAAAAAAAAAAGG - Intergenic
953227558 3:41034365-41034387 CTGTGAAAGATAAAGGTAGAGGG - Intergenic
954030612 3:47817463-47817485 CTCTTTTAGAAAGAGGGAGAAGG + Intronic
954550942 3:51481222-51481244 CTCTGTAGGAAAAAGGAAGTCGG + Intronic
954896533 3:53979733-53979755 CTCTTTAAAAAAAATAAAGATGG + Intergenic
955040641 3:55314429-55314451 TTGTTTAAAAAAAAAAAAGAGGG + Intergenic
955568601 3:60277483-60277505 CTGGCAAAGAAAAGGGAAGATGG - Intronic
955743576 3:62118522-62118544 CTGATCTAGAAAAAGGAAAAAGG + Intronic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
956315617 3:67932824-67932846 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
956425420 3:69129478-69129500 CTGTTTTAGAAAAAGTAAAATGG - Intergenic
956817782 3:72924068-72924090 ATGTTTAAGAAAATAAAAGAAGG + Intronic
957127486 3:76180487-76180509 CTACTTGAGAAAATGGAAGATGG - Intronic
957208228 3:77226958-77226980 CTGTTAAAGAAAAATGAAGTTGG - Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
958974273 3:100648550-100648572 ATGTTTATGAAAAAGTAAAATGG + Intronic
959285572 3:104404779-104404801 CTGATTAAGAAAAAAAGAGAGGG + Intergenic
959568011 3:107852535-107852557 CTGTGTATGAACCAGGAAGAGGG + Intergenic
960265664 3:115618376-115618398 CTTTCTAAGAAAGAGAAAGATGG + Intergenic
960546822 3:118924839-118924861 TTGTTTAAAAAAAAGCAACAAGG + Intronic
960735531 3:120775391-120775413 CAGTTCAAGAAACATGAAGATGG + Intronic
961170672 3:124795754-124795776 CTGGTTTTGAAAATGGAAGAAGG + Intronic
961235186 3:125360257-125360279 CTGTCTAAAAAAAAAGATGAAGG - Intronic
961797131 3:129417524-129417546 CTATTTAAAAAACAGGAAGCAGG + Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
962626807 3:137233816-137233838 CTGTTCAAGAAGGAGGAATACGG - Intergenic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
962915142 3:139894468-139894490 GTGTTTAAGAAACAGAAAGGAGG + Intergenic
963038846 3:141053947-141053969 GTGTTGGAGTAAAAGGAAGAAGG - Intronic
963308997 3:143687737-143687759 CTGTTAAAAAAAAAAGAAGTTGG + Intronic
963508213 3:146214421-146214443 CCATTAAAAAAAAAGGAAGAGGG - Intronic
964282929 3:155086632-155086654 TTCTTCAAGAAAAAGGAAGGTGG + Intronic
964606673 3:158567594-158567616 CTGTTTAAGACAAAGGGATTAGG + Intergenic
964682826 3:159361390-159361412 CAGTTTAAGGAAGAGCAAGAAGG + Intronic
964696685 3:159516081-159516103 ATGTTTAAGATCCAGGAAGAAGG - Intronic
964934687 3:162068416-162068438 CTGTTAAATAAAAAGAATGAGGG + Intergenic
965171321 3:165268285-165268307 CTTTGTAAGAGAAAGGGAGAGGG - Intergenic
965763464 3:172106164-172106186 CTCTTTAAAAAAAAGGTTGATGG - Intronic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
966006208 3:175015614-175015636 GTGTTTCAGAAAACAGAAGAAGG + Intronic
966017657 3:175162176-175162198 CTGGTTAAGAAAGAGAGAGAAGG - Intronic
966200115 3:177353368-177353390 GTGTTTAAGAAACAGCAAAAAGG + Intergenic
966491027 3:180529069-180529091 CTGCTTGAGAAAAAAGCAGAGGG + Intergenic
966498860 3:180613851-180613873 TTGTTTTAGAAATAGGAAAAAGG - Intronic
967144523 3:186595212-186595234 ATCTTTAATATAAAGGAAGAGGG - Intronic
967677539 3:192317494-192317516 CTGCTTAAGGAAAGGGAAAAAGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968144706 3:196288256-196288278 GTGGGTCAGAAAAAGGAAGAGGG - Intronic
968825236 4:2891150-2891172 CTTTTTAAGATAAAGGAGGCTGG + Intronic
969007871 4:4036294-4036316 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
969028255 4:4191520-4191542 TGGTTTGAGAAACAGGAAGAAGG - Intronic
969952017 4:10846822-10846844 CTATTTAATAAAATGGAACACGG + Intergenic
970146553 4:13042208-13042230 CTGCCTAAGAGAGAGGAAGAAGG - Intergenic
970246300 4:14067667-14067689 CTTTTTAATGAAAAGAAAGAAGG + Intergenic
970573596 4:17406212-17406234 CTCTCTGAGACAAAGGAAGATGG - Intergenic
970669570 4:18380529-18380551 CAGTCTAGGAAAAAGGAACAGGG + Intergenic
970696976 4:18689745-18689767 CTGATTAAAAATAAGGAATAGGG - Intergenic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
971100122 4:23457203-23457225 CTGTTTAAGAAAAAGAATGCAGG - Intergenic
971124646 4:23740093-23740115 CTGTTTATAAAATAGTAAGATGG - Intergenic
971379731 4:26085703-26085725 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
972411418 4:38799295-38799317 TTTTTTAAGAGAAAGGCAGAGGG + Intronic
972597980 4:40546975-40546997 CTGCTTAAGAAACATGAATATGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972802572 4:42492558-42492580 CTGTCTATGAACCAGGAAGAAGG + Intronic
972932252 4:44086781-44086803 CTGCTTAAGAAAAAGGAGTCTGG - Intergenic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
973319116 4:48792196-48792218 CTTTTCAAGACAAAGAAAGAAGG + Intergenic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973742669 4:53933404-53933426 ATGTTAAAGAAACAGGCAGAAGG - Intronic
974950052 4:68576620-68576642 ATGTTTAAGAAAAAACAACAAGG - Intronic
975654621 4:76629286-76629308 CTGTTTGAAAAAGAGCAAGAAGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975806686 4:78120026-78120048 CTGATTAAGACAAAAGAACAAGG - Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
975932682 4:79544553-79544575 GTGTTTCAGAAAACAGAAGAAGG - Intergenic
976035873 4:80820490-80820512 GTGTTTAAGGAACAGCAAGAAGG + Intronic
976791065 4:88879483-88879505 CTATTAAAAAAAAAAGAAGAAGG + Intronic
976912698 4:90326968-90326990 TTGCTTATGAAAAATGAAGATGG - Intronic
977035955 4:91953819-91953841 CTGTTTATGAAAAGGTAAGTTGG - Intergenic
977232598 4:94469483-94469505 GTGTTTAAGAAATAGAAAGAAGG + Intronic
977314899 4:95433868-95433890 CTGTGTGAGAAAAAGAGAGAAGG - Intronic
977587021 4:98785251-98785273 CTGGTTAAGAAAATAGCAGATGG - Intergenic
977745602 4:100543046-100543068 CGCTTTAAGAAAAAGAAAAAAGG - Intronic
977861496 4:101966241-101966263 CTATTTTGCAAAAAGGAAGAAGG - Intronic
978366063 4:107983308-107983330 CTGGTTAAGAAAAAGTTATAAGG + Intergenic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
978843381 4:113242629-113242651 CTGCTTAAGAAAAATGAATTAGG - Intronic
978926200 4:114248624-114248646 CTGATTAAGAAAAAGAATTAAGG - Intergenic
979040628 4:115788440-115788462 TTCTTTAAGATAAAGGAACAAGG - Intergenic
980181825 4:129410638-129410660 CTTTATAAGGCAAAGGAAGAAGG - Intergenic
980369802 4:131852611-131852633 CTGTCTCAAAAAAAAGAAGAAGG + Intergenic
981006536 4:139880903-139880925 ATATTTAAGAACAAAGAAGATGG + Intronic
981365931 4:143903119-143903141 CTGCTTAAGAAAAGGGTAGCAGG - Intronic
981376037 4:144016931-144016953 CTGCTTAAGAAAAGGGTAGCAGG - Intronic
981386561 4:144138290-144138312 CTGCTTAAGAAAAGGGTAGCAGG - Intronic
981922643 4:150102304-150102326 CTATTTAAAAGAAAGGAAGGTGG + Intronic
981930328 4:150182389-150182411 CTGTTTAAGAAAAATGGAGTGGG + Intronic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
982273043 4:153610928-153610950 TAGTTCAAGAAAAAAGAAGAAGG + Intronic
982523695 4:156451878-156451900 CTGTTTATGAACAAGAAAGCAGG - Intergenic
982638003 4:157921518-157921540 CTATTTAAGAAAAATATAGAAGG + Intergenic
982751216 4:159164320-159164342 CCGTTTAATAAAGAAGAAGAAGG - Intronic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983211819 4:164966246-164966268 CTGTTATAGAAAAAGCAAAAAGG + Intronic
983311644 4:166071340-166071362 ATCATTAGGAAAAAGGAAGAGGG - Intronic
983482468 4:168291807-168291829 CTCTTTGAGAAAGAGGCAGATGG + Exonic
983501641 4:168506242-168506264 CTGTTGTAGAAAAAGGGGGAAGG - Intronic
983832946 4:172352949-172352971 CTGTCTAAGCAAAAGTAAGCTGG - Intronic
983900260 4:173126269-173126291 CTGTATAAAAAAAAGGTAAAAGG + Intergenic
984051868 4:174874243-174874265 ATGTTCAAGAAATAGAAAGAAGG - Intronic
984409160 4:179372708-179372730 CTGTTAAACAAAAAGGAATCAGG - Intergenic
984660567 4:182369871-182369893 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
985101672 4:186464226-186464248 GTCTTTAAGAAAAAGGAGGGGGG + Intronic
985397678 4:189561483-189561505 CTTTTGAAGAAAATGGAAGTAGG + Intergenic
986752464 5:10801070-10801092 CTGACCAAGAGAAAGGAAGAAGG + Intergenic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
986933742 5:12857774-12857796 CTGTGTAACAAAAAGAGAGAGGG - Intergenic
987102928 5:14608348-14608370 CTGTCTATAAAACAGGAAGAGGG - Intronic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
988815088 5:34826766-34826788 CTGTTGCAGAAAAAGGAGAAGGG - Intronic
988899767 5:35719328-35719350 TTTTTTAACAAAAATGAAGATGG - Intronic
989410902 5:41119479-41119501 CTATTAAAAAAAAAAGAAGAAGG - Intergenic
989564303 5:42886202-42886224 CTGCTGTAGGAAAAGGAAGAAGG - Intronic
989619573 5:43371062-43371084 CAGATTAAGAAAAAAGAAGAAGG - Intergenic
989839395 5:46043002-46043024 TTGGTTAAGAAATAGAAAGAAGG + Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
990055216 5:51567616-51567638 CTGCTCAAGAAAAGGGATGATGG - Intergenic
990081016 5:51913705-51913727 CTGGTGGAGAGAAAGGAAGAGGG + Intergenic
990372535 5:55135391-55135413 CTGTTTAGGACAAAAGACGAGGG + Intronic
990869346 5:60414923-60414945 TTGGTTAAGACACAGGAAGAAGG + Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991214662 5:64148626-64148648 TTGTTAAAGAAAAATAAAGATGG + Intergenic
991261330 5:64671572-64671594 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
991292619 5:65047291-65047313 GTGTTTAAGGAAGAGCAAGAAGG - Intergenic
992417114 5:76562290-76562312 GTGTTGGAGACAAAGGAAGAAGG - Intronic
992970060 5:82047230-82047252 TTGTTTAATAAAAAGTATGAGGG + Intronic
993337955 5:86684722-86684744 CTGTTTAGGAACCAGGAAGCAGG + Intergenic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993593300 5:89822974-89822996 CTGTTTAAGAACCAAGAAGTGGG + Intergenic
993601345 5:89928766-89928788 TTGTTAAAGAAAGAGGCAGAGGG + Intergenic
993625438 5:90219269-90219291 CAATTTAAGAAAATGAAAGAAGG + Intergenic
993907225 5:93636524-93636546 CTGTCTATGAAAAAGAAAGCAGG + Intronic
994592485 5:101790132-101790154 AGTTTTAAGGAAAAGGAAGAAGG + Intergenic
994913992 5:105948796-105948818 ATGTGTAAGAAAACGGAAGTAGG + Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995399519 5:111724753-111724775 CTGTTTAAAAGAAATGAAGAAGG - Intronic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995925859 5:117372695-117372717 CTTTTTCAGAAAATAGAAGATGG - Intergenic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
996106214 5:119507029-119507051 CTCTTTAAGAAAAATAAAGAAGG + Intronic
996281056 5:121729355-121729377 TTGTTTAATAAAAAGAAAGAAGG + Intergenic
996370344 5:122746672-122746694 ATGTGTAAGAAAAGGAAAGAGGG + Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
997828409 5:137128178-137128200 CTGTCTATGAAACAGGAAGTAGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998389015 5:141774922-141774944 ATGTTTGAGAAACAGCAAGAAGG - Intergenic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999589997 5:153134337-153134359 CTGCTTCAGTAAAAGGAAGTTGG + Intergenic
1000231849 5:159323089-159323111 CTGCTTCACAAAAAGGAAGATGG - Exonic
1000373979 5:160562321-160562343 ATATTTAAGGAAAAGGAAGGAGG - Intergenic
1000601145 5:163276161-163276183 CTGTTTTATAAAATAGAAGAAGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1001012972 5:168115286-168115308 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1001072796 5:168601336-168601358 GTGTTCAAGAAATAGCAAGATGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001666419 5:173437059-173437081 GTGTTTAAAAAAAAGTAAGAAGG + Intergenic
1001889181 5:175324738-175324760 CTGCTTACAAAAAAGGGAGAGGG + Intergenic
1002079668 5:176729854-176729876 CTGTTTAAGAAAAGGGCAAAAGG + Intergenic
1002448197 5:179302872-179302894 ATGTTTGAGGAAAGGGAAGAAGG + Intronic
1002518435 5:179776105-179776127 CTGTTTTTGGAAAACGAAGATGG + Exonic
1004266357 6:14151549-14151571 CTTTTCAAAAAAAAGGAAGGAGG - Intergenic
1004370111 6:15044897-15044919 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1004739750 6:18447320-18447342 CTGTTTGAGAAACAGCAAGGAGG + Intronic
1004756476 6:18615935-18615957 CTATTCAAGAGACAGGAAGAGGG + Intergenic
1004784794 6:18955945-18955967 ATGTTTAACAATAAGGAAGCAGG - Intergenic
1004923727 6:20400416-20400438 CTGTTTCAGAAAAGGTAACAAGG + Intergenic
1005181144 6:23108376-23108398 CTGATAAAGAGAAGGGAAGATGG + Intergenic
1005952779 6:30643687-30643709 CTGTCTAAGAAAGTAGAAGAGGG - Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007020236 6:38512438-38512460 CTATTTAAGAATAAGGATGTGGG + Intronic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1007743388 6:44026828-44026850 ATGTTTGAGAAACAGCAAGAAGG + Intergenic
1007823022 6:44575943-44575965 CTGTTTACAAAAAAGAGAGAGGG + Intergenic
1008361847 6:50629029-50629051 CTGTTTAAAAAAAAAGATAAAGG + Intergenic
1008413253 6:51207948-51207970 GTGCATAATAAAAAGGAAGACGG - Intergenic
1008420632 6:51295108-51295130 CTGTTTAAGAGATAGGCAAATGG + Intergenic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008638010 6:53431947-53431969 CTGTCTATGAACAAGGAAGCAGG - Intergenic
1009382204 6:63045936-63045958 CTGTTTAATAAAGAATAAGAAGG + Intergenic
1009629831 6:66181685-66181707 GTGTATAAGAAACAGCAAGATGG + Intergenic
1010307908 6:74346271-74346293 CTTTCTAAGAAAGAGGAAGAAGG + Intergenic
1010623138 6:78101514-78101536 CCTTTTAAGAAAAAGGCAGATGG + Intergenic
1011050923 6:83149011-83149033 CTGTTTAAGAAAAAAAAAAGTGG + Intronic
1011078617 6:83464937-83464959 CTGTGTAGTAAAAAGGCAGAGGG + Intergenic
1011105738 6:83778305-83778327 CTGATAATGAAAGAGGAAGAGGG + Intergenic
1011114372 6:83874193-83874215 CTGTTTCAAAAAAAATAAGAGGG - Intronic
1011126720 6:84015492-84015514 CTGTTTAAGGAAAAGCTATAGGG - Intergenic
1011161412 6:84394483-84394505 CTTCTTAAGTAAAAGAAAGAAGG - Intergenic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1011513515 6:88127263-88127285 GGGTGAAAGAAAAAGGAAGATGG + Intergenic
1012070974 6:94615774-94615796 CTAATTAAGAAAAATGAAAAAGG + Intergenic
1012136021 6:95556998-95557020 CAGATTAATAAAAAGGAAGTGGG - Intergenic
1012478482 6:99640325-99640347 CTCTTTGGGAAAAAGGATGATGG + Intergenic
1012520070 6:100110557-100110579 CTGCTGAAGAAAAGGGAAGGAGG + Intergenic
1012839640 6:104313526-104313548 CTTTTTAAGAAATAAGTAGAGGG + Intergenic
1013367769 6:109448081-109448103 GTGTGTCAGAAAGAGGAAGAAGG - Intronic
1013453442 6:110307975-110307997 CTGTTGAAGAAATAGGAAGGGGG + Intronic
1013490036 6:110637429-110637451 GTGTTTAAAGAAAAGGAAGTTGG + Intronic
1013548949 6:111188314-111188336 ATAGTTAAGAAAAAGGAAAAAGG - Intronic
1013657885 6:112264375-112264397 CTGAGTAATAGAAAGGAAGAAGG + Intergenic
1013761141 6:113519761-113519783 TTTTTTAAGAAAAATAAAGATGG + Intergenic
1013865763 6:114694501-114694523 TTGTTTAAGACAAGGAAAGAAGG + Intergenic
1014450720 6:121578264-121578286 ATATTTAAGAAAAGGGAAGAAGG + Intergenic
1014602478 6:123430914-123430936 CTGTTTTAGAGAAAGTAAGATGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014757160 6:125314171-125314193 CTGTTTAATAAAAAGGTAATTGG + Intergenic
1014852420 6:126358194-126358216 CAATTTAGGAAAAAGAAAGAAGG - Intergenic
1015094377 6:129397263-129397285 GTATTTAAGAAACAGAAAGAAGG - Intronic
1015222814 6:130824409-130824431 TTGTTTAAGACATAGGAGGAAGG - Intergenic
1015535065 6:134259104-134259126 CTATCTAAGATAAAGGAAAAGGG + Intronic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1016063068 6:139650380-139650402 ATGTTTAAAAAACAGAAAGAAGG - Intergenic
1016080959 6:139855425-139855447 CTGTTTAAGCAATGAGAAGATGG - Intergenic
1016835109 6:148469382-148469404 CTGTTTCAGAAACATGAAAATGG + Intronic
1017126914 6:151073580-151073602 ATGTTTAAGAAACTAGAAGAAGG + Intronic
1017238569 6:152142308-152142330 CAATTTAAGAAAGAGAAAGAGGG - Intronic
1017316758 6:153039913-153039935 CTTATAAAGAAAAGGGAAGAAGG + Intronic
1017354616 6:153488812-153488834 CTGTTTAACAAATAGAAAGCAGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017831805 6:158137267-158137289 TTGTTTAAAAAAAAAGAACAGGG + Intronic
1018394158 6:163364512-163364534 CTTTTTTAGCAAAAGGAAAATGG + Intergenic
1018496456 6:164351335-164351357 ATGTTCAAGAATAAGGAAGTAGG + Intergenic
1019388149 7:770328-770350 CTGATTGAGAAAGAGGAAGCGGG + Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019848893 7:3534859-3534881 CTGATAAAGAGAAGGGAAGATGG - Intronic
1020799666 7:12718117-12718139 CTGTCTCAAAAAAAAGAAGAAGG - Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021199847 7:17716386-17716408 CTTTTTAAGGAAAAAGAAAAAGG - Intergenic
1021367113 7:19793253-19793275 CTGATAAAGAGAAGGGAAGAAGG + Intergenic
1021455884 7:20829292-20829314 CTATTTAAGTAACAGAAAGAAGG - Intergenic
1021845845 7:24761773-24761795 ATGTTCAAGAAAAAGAAACAAGG + Intergenic
1021865883 7:24956549-24956571 GTGCGTAAGACAAAGGAAGATGG - Intronic
1021932830 7:25598659-25598681 CTGCTGAAGAAAGAGGATGAAGG + Intergenic
1022495835 7:30852574-30852596 ATGCTAAAGAAAGAGGAAGAAGG - Intronic
1022847493 7:34225621-34225643 CAGGTTCAGACAAAGGAAGAAGG + Intergenic
1022971164 7:35518608-35518630 CTCTTGAAGAAATAGGAGGATGG - Intergenic
1023148237 7:37174197-37174219 CTTTATAGGAAAAAGGAAGTGGG - Intronic
1023372175 7:39522572-39522594 CTGTTTCAAAAAAAAAAAGAAGG + Intergenic
1023421730 7:39987312-39987334 CTGTCTCAGAAAAAAGAAGTAGG - Intronic
1023805081 7:43867208-43867230 TTATTTTACAAAAAGGAAGATGG + Intronic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024362137 7:48479240-48479262 CTGTCTCAAAAAAAGGAAAAAGG - Intronic
1024752112 7:52478593-52478615 CTGTTAAAGAGAAGGGAAGATGG + Intergenic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1024963089 7:54997774-54997796 CTGTTTAAGCAAAGAAAAGAGGG - Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1027512546 7:79101420-79101442 TGGTTTTAGAAAAAGGAAAATGG + Intronic
1027590022 7:80106956-80106978 CTGATAGAGAGAAAGGAAGAGGG + Intergenic
1027613500 7:80392029-80392051 CAGTTTTTGAAAAATGAAGAAGG + Intronic
1028780550 7:94730522-94730544 CACTTTCACAAAAAGGAAGAGGG + Intergenic
1028843226 7:95451379-95451401 CCATTTAGGAAAAATGAAGATGG - Intergenic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1030000296 7:105052340-105052362 CTATTTTAGATAATGGAAGAGGG - Intronic
1030157073 7:106466102-106466124 CAATTTAAAAAAAAGAAAGAGGG - Intergenic
1030618087 7:111759562-111759584 CAGTTTCAGGAAAAGGCAGAGGG + Intronic
1030838445 7:114317846-114317868 GTGTTTAACAAACAGCAAGAAGG - Intronic
1031073461 7:117189298-117189320 CTGTTGGAGAAAAAGAAAGTAGG - Intronic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031424170 7:121585597-121585619 TTGACAAAGAAAAAGGAAGATGG - Intergenic
1031680874 7:124673190-124673212 GTTTTTAAGAAAAGGGTAGAAGG - Intergenic
1031704803 7:124966318-124966340 CTAGTTAAGGAAATGGAAGAAGG + Intergenic
1032133630 7:129253200-129253222 CTGTTTCAAAAAAAAAAAGAAGG + Intronic
1032297110 7:130649341-130649363 CTGTTAAACAAAAAGGAACCAGG - Intronic
1032544911 7:132733979-132734001 CCCTTTAAGTGAAAGGAAGAAGG + Intergenic
1032631841 7:133661626-133661648 CAGGTAAAGAAAAAGGCAGAAGG - Intronic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1032856309 7:135836547-135836569 GTGTTTCAGATAAGGGAAGAAGG + Intergenic
1032856540 7:135838311-135838333 CCGTTTAAGAAATAGAAAGGAGG + Intergenic
1032899244 7:136288211-136288233 CAATTTAAGACATAGGAAGAAGG + Intergenic
1033192109 7:139290766-139290788 CAGTTAAAGAACCAGGAAGAAGG + Intronic
1033397973 7:140993689-140993711 AAGTTGAAGAAAAAGCAAGAGGG - Intergenic
1033441652 7:141385604-141385626 CTCCTTAACAAAAAGGATGATGG - Intronic
1033574692 7:142669442-142669464 ATGTTAAAGAAACAGGAAAACGG - Intergenic
1033591348 7:142811368-142811390 CTTTTTAAGAACAAGGACTAGGG + Intergenic
1033765404 7:144484311-144484333 CTATTTAAAAAAAAGGAAAATGG + Intronic
1034016950 7:147597718-147597740 CTTTTTAAGAAAAGTGATGAAGG - Intronic
1034111122 7:148538520-148538542 CTATTGAAAAAAAAGGAACAGGG - Intergenic
1034744107 7:153507145-153507167 GTGTTTCAGTAAATGGAAGAAGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036615532 8:10384705-10384727 CTGTTAAAGAAAAAATAAAATGG + Intronic
1037093671 8:14955080-14955102 CTATTGAAGAAAAAAGGAGAAGG - Intronic
1037504712 8:19518355-19518377 CTGATAAAGAGAAGGGAAGATGG - Intronic
1037610571 8:20472891-20472913 CTCTTTAAAACAAGGGAAGAAGG + Intergenic
1037612906 8:20491405-20491427 CTGTTCAAAAAAAATGAGGAAGG + Intergenic
1038501720 8:28050379-28050401 CTGTTAAAAAAAAAGAAAAAAGG + Intronic
1038645558 8:29358792-29358814 TTGTCTAAGAGAAAGGAATAAGG - Intergenic
1039061946 8:33578942-33578964 GTGTTTCAATAAAAGGAAGAAGG + Intergenic
1039062704 8:33584445-33584467 TTATTTAATAAAAAAGAAGAGGG - Intergenic
1039155655 8:34554003-34554025 TTCTTTAAGATAAGGGAAGAAGG + Intergenic
1039357948 8:36841974-36841996 CTGTTAAAAAAAAAAGAAAAGGG + Intronic
1039361916 8:36885786-36885808 CTGTCTAAAAAAAAAGAAAAAGG + Intronic
1039502186 8:38027007-38027029 CTGCTCTAGAAAAAGGTAGAGGG + Intergenic
1039507938 8:38065625-38065647 CTGTTTAAGAAAAAAGAAAAAGG + Intergenic
1039895140 8:41711927-41711949 CTGTCTAAAAAAAAAAAAGATGG - Intronic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041618588 8:59937321-59937343 CTTTGTAATAAAAAGTAAGAAGG - Intergenic
1041654137 8:60331582-60331604 CTTTTTAATAAAAAGAAAAATGG + Intergenic
1041724426 8:61004825-61004847 CTTTTTAAGAAAAATGAAAGGGG - Intergenic
1041749185 8:61240304-61240326 CTGTTGAAGAAACAGGAAAATGG - Intronic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1042065537 8:64870752-64870774 GTTTTCAAGAAAAAGGGAGAGGG + Intergenic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1042655103 8:71087300-71087322 CTGTTTAAAAAAAAATTAGAAGG - Intergenic
1042689462 8:71481811-71481833 CTGATGGAGAAAAAGGAAGGAGG + Intronic
1043078730 8:75736703-75736725 CTGTTTGAGCAAAAGGCAAATGG + Intergenic
1043261749 8:78209154-78209176 CTGTTTAAGCAAATGCAAAATGG + Intergenic
1043265474 8:78262248-78262270 CTGTTTAGGAGAGAGGAAAAGGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1044319171 8:90783124-90783146 CTGTTTACAAAAGAGGAAGAGGG + Intronic
1044500243 8:92946420-92946442 CCCTTTAAGAAAGAGGCAGATGG - Intronic
1044527496 8:93267974-93267996 CTGTTTAAGAAATAGAAAAGAGG - Intergenic
1044655293 8:94541969-94541991 CCAGCTAAGAAAAAGGAAGAGGG + Intronic
1044668958 8:94659190-94659212 TTGTTTAAAAAAAAAGAAAATGG + Intronic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1045496113 8:102710290-102710312 TTTTCTAAGAAAAAGGAAGTAGG + Intergenic
1045681672 8:104667290-104667312 CTGATAAAGAGAAGGGAAGATGG - Intronic
1046263065 8:111796295-111796317 CTGACAAAGAGAAAGGAAGACGG - Intergenic
1046264857 8:111817440-111817462 CTGTTTATGAACCAGGAAGCAGG - Intergenic
1046619601 8:116514406-116514428 GTGTTGAAGAGACAGGAAGAAGG - Intergenic
1046773069 8:118136031-118136053 CTGTCTAAAAAAAAAGAAAAAGG - Intergenic
1047021502 8:120779617-120779639 CTGACTAGGACAAAGGAAGAGGG + Intronic
1047064941 8:121271331-121271353 CTTTTAAAGAAATAGGAGGATGG + Intergenic
1047067843 8:121306450-121306472 CTGTTTCTGCAAAAGTAAGAGGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047902162 8:129435078-129435100 CTGTTTAACAAAAAGAAACCAGG + Intergenic
1048017949 8:130514176-130514198 CTGTTTAAAAAAAATAAAAAAGG + Intergenic
1048912839 8:139152624-139152646 ATGTTTAAAAAAAAGAAAGGTGG + Intergenic
1049037100 8:140085333-140085355 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050210915 9:3255151-3255173 CAGTTTAAGAAATAAGAATATGG + Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1050905544 9:11000122-11000144 CTACTTAAGAGAAAGGAACAGGG - Intergenic
1050910619 9:11065000-11065022 CTGACGAAGAAAAGGGAAGATGG - Intergenic
1051118540 9:13726176-13726198 CTATTTAAATAAAAGGATGACGG - Intergenic
1051230352 9:14949403-14949425 CAATTTAGGAAAGAGGAAGAGGG + Intergenic
1051342393 9:16123608-16123630 GTGATTAAGAAAAAGGAAAAAGG - Intergenic
1051666448 9:19471097-19471119 CTCTTGAAGAGAAAGCAAGAAGG + Intergenic
1051722582 9:20053709-20053731 CTGTTTATGAACCAGGAAGCAGG + Intergenic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1052005075 9:23337497-23337519 CTGTTTAAAAAATTGGAAAAGGG + Intergenic
1052090028 9:24316588-24316610 CTGTTTAAGACCCAGAAAGAAGG + Intergenic
1052252272 9:26412302-26412324 CTGTCTATGAAACAGGAAGCAGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055168974 9:73231369-73231391 ATGTTTAAGAAACAGCAAGTAGG + Intergenic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055573629 9:77641570-77641592 CTGTTAAAAAAAAAGGGAGAGGG + Intronic
1055600053 9:77907045-77907067 CTATTTGAGAAAAAGAAAAAAGG + Intronic
1055633333 9:78247440-78247462 GTATTTAAGGAAAAGCAAGAAGG + Intronic
1056277094 9:85003970-85003992 CTATTTAAGGAGAAAGAAGAAGG + Intronic
1056597596 9:88020475-88020497 CTGCTTAAGAGAAAGGGAGATGG - Intergenic
1056975745 9:91251593-91251615 CTGTAAAAGAAAAAGGGAAAGGG + Intronic
1057135940 9:92687994-92688016 CTGTCTCAAAAAAAGGAGGAGGG - Intergenic
1057267422 9:93628270-93628292 CTTTTTCAGAAAATAGAAGAGGG - Intronic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1057932099 9:99202959-99202981 CTTTTTAAGAAAAAAAAGGATGG + Intergenic
1058834835 9:108851832-108851854 CTGGTATAGAAAAAGGAGGAGGG - Intergenic
1058875437 9:109240126-109240148 CAATTTAAAAAAAATGAAGATGG + Intronic
1059369821 9:113819206-113819228 ATGTTCAAGAAAATAGAAGAAGG + Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059773172 9:117447078-117447100 CCGTTCAAGAAAAAGAAAGGGGG + Intergenic
1060378954 9:123147055-123147077 CTGTTAAAGAAAGAGGAATGAGG + Intronic
1060571153 9:124641680-124641702 CTGTTTCAAAAAAAGAGAGAGGG + Intronic
1060647874 9:125297562-125297584 CTGTTCAAGGAACAGCAAGAAGG + Intronic
1061725090 9:132578039-132578061 CTGCTTTAAAAAAAGAAAGACGG + Intergenic
1061750527 9:132773931-132773953 GTGTTTAGGAAACAGGAAGTGGG + Intronic
1061999469 9:134208646-134208668 CTATTTAAGGAATGGGAAGACGG - Intergenic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1062257031 9:135630975-135630997 CTGTGTAAAAAAAAAAAAGACGG + Intronic
1062665862 9:137671214-137671236 CAGTGTAAGAAAAAAGCAGAAGG + Intronic
1185582676 X:1223071-1223093 ATGATGAAGAAAAAGGAAGCGGG - Intergenic
1185920305 X:4084031-4084053 CTTCTTAAGGGAAAGGAAGATGG + Intergenic
1186118309 X:6328560-6328582 CTGTCTCAAAAAAAAGAAGAAGG + Intergenic
1186208426 X:7224595-7224617 CTGTCTATGAAACAGGAAGCAGG + Intronic
1186338015 X:8613210-8613232 CTGTTTCAAAAAAAAAAAGAAGG - Intronic
1186607147 X:11104206-11104228 CTGTTAAATAAAAAGAAAGATGG + Intergenic
1186708002 X:12163042-12163064 CTCATTAAAAAAAAGGAGGAAGG + Intronic
1187664941 X:21596515-21596537 TTGTTTTAGAGAAAGGTAGATGG - Intronic
1187808852 X:23153279-23153301 CTGTTTCAGCCAAAGGAACATGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188142918 X:26574189-26574211 CCGTCTAAGATAAAGTAAGATGG + Intergenic
1188148121 X:26639167-26639189 CTGTTTGAGGAATAGCAAGAAGG - Intergenic
1188300217 X:28498442-28498464 CAGGTCAGGAAAAAGGAAGAAGG + Intergenic
1188688043 X:33094504-33094526 ATATTTAAGAAAGAGCAAGAAGG + Intronic
1188810657 X:34650407-34650429 ATGATTAAGGAAAATGAAGAAGG - Intronic
1188946581 X:36312375-36312397 CTGTTGGAGAAAAAGGAACATGG + Intronic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189284101 X:39839729-39839751 CTGTCTAAGAAAAAATAAAAAGG - Intergenic
1189499763 X:41545598-41545620 CTCTTGAAGAACAAGGAAGGAGG - Intronic
1189581004 X:42406368-42406390 CCGTCTCAGAAAAAGAAAGAAGG + Intergenic
1189793965 X:44629701-44629723 CTCTCTATGAAACAGGAAGAAGG + Intergenic
1189927355 X:45970743-45970765 ATGTTTAAGGAATAGTAAGATGG + Intergenic
1189953887 X:46259091-46259113 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1190869411 X:54412744-54412766 ATGTTTAAGAAACAGAAACAAGG + Intergenic
1191084608 X:56550930-56550952 AGGTTTAAGATGAAGGAAGAAGG - Intergenic
1192011739 X:67280240-67280262 CTGTTCAAAAAAGAGAAAGAAGG + Intergenic
1192077509 X:68015395-68015417 ATGTTTGAGGAAAAGGAAGAAGG + Intergenic
1192118048 X:68430131-68430153 GTGTTGAGGAAAAAGGAAAAAGG - Intronic
1192126970 X:68510194-68510216 CTGATTAAGATATAGGAAGCTGG - Intronic
1192133987 X:68579949-68579971 GTGTTTGAGAAACAGGATGAAGG + Intergenic
1192241187 X:69330364-69330386 CTGATTAAAAAAATTGAAGAGGG - Intergenic
1192250190 X:69406564-69406586 GTGTTTAAGGTAAAGCAAGAAGG + Intergenic
1192743696 X:73917861-73917883 CAGTTTAGGAGACAGGAAGAGGG + Intergenic
1192840244 X:74847748-74847770 CTTTTTAAAAATAATGAAGAAGG - Intronic
1193791424 X:85819888-85819910 CTGATAAAGAGAAGGGAAGATGG - Intergenic
1194092035 X:89589927-89589949 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1194464790 X:94220185-94220207 ATATTTAAGAAAAACAAAGACGG - Intergenic
1194482147 X:94439722-94439744 CTGACAAAGAGAAAGGAAGATGG + Intergenic
1194692310 X:97002008-97002030 CTGTTTAAAAAAAAAGGTGATGG + Intronic
1195041532 X:101019328-101019350 CTGCTAAAGTCAAAGGAAGATGG - Exonic
1195235358 X:102891497-102891519 CTATTTAAGAAAATGTAAAAAGG + Intergenic
1195573678 X:106425227-106425249 GTGTTTGAGAAACAGCAAGAAGG - Intergenic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195992918 X:110700722-110700744 CTGTTTATTAAAAAGAAATAAGG + Intronic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196470901 X:116025323-116025345 CTGTTTAAGAAAAATAAAATTGG + Intergenic
1196490372 X:116258574-116258596 TTGTTTAAGAAACAGCATGAAGG + Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197101875 X:122665587-122665609 CTGTTTGAGAAATGCGAAGATGG - Intergenic
1197831912 X:130651958-130651980 TTGTTCAATAAAAAGGAAGGAGG - Intronic
1198229836 X:134678329-134678351 ATGTTTGAGAAAAAGCAAGGAGG - Intronic
1198272755 X:135070070-135070092 CTCTTAAAGAAACAGGAGGAAGG + Intergenic
1198306216 X:135385731-135385753 CTATTTACAAACAAGGAAGATGG - Intergenic
1200354467 X:155533897-155533919 CTGTTAAACAAAAAGGAACCAGG + Intronic
1200376715 X:155788559-155788581 ATGTTTAAGAAAATGAAAGAAGG - Intergenic
1200444667 Y:3245965-3245987 CTTCTTAGGGAAAAGGAAGATGG - Intergenic