ID: 1044865723

View in Genome Browser
Species Human (GRCh38)
Location 8:96569250-96569272
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044865723_1044865729 -8 Left 1044865723 8:96569250-96569272 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1044865729 8:96569265-96569287 TTCCAAAGTGTTGGGATTACAGG 0: 978
1: 32713
2: 325405
3: 254412
4: 133373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044865723 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr