ID: 1044865926

View in Genome Browser
Species Human (GRCh38)
Location 8:96571293-96571315
Sequence CATTTCAGGCAGAGGCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044865919_1044865926 23 Left 1044865919 8:96571247-96571269 CCTATGAAATGAGAGGGAACTGA 0: 1
1: 0
2: 3
3: 20
4: 238
Right 1044865926 8:96571293-96571315 CATTTCAGGCAGAGGCAGAGCGG No data
1044865923_1044865926 0 Left 1044865923 8:96571270-96571292 CCACACAAAAGGCTTGAGGGAAG 0: 1
1: 0
2: 0
3: 19
4: 241
Right 1044865926 8:96571293-96571315 CATTTCAGGCAGAGGCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044865926 Original CRISPR CATTTCAGGCAGAGGCAGAG CGG Intronic
No off target data available for this crispr