ID: 1044866018

View in Genome Browser
Species Human (GRCh38)
Location 8:96572030-96572052
Sequence CACTGATGGCCTTTAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044866018_1044866022 1 Left 1044866018 8:96572030-96572052 CCTTCTGTTAAAGGCCATCAGTG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1044866022 8:96572054-96572076 TGGCTCAAGCAGTCTCGTGGAGG No data
1044866018_1044866021 -2 Left 1044866018 8:96572030-96572052 CCTTCTGTTAAAGGCCATCAGTG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1044866021 8:96572051-96572073 TGCTGGCTCAAGCAGTCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044866018 Original CRISPR CACTGATGGCCTTTAACAGA AGG (reversed) Intronic
903269286 1:22177682-22177704 CACTGATCTCCTTTTACAGATGG + Intergenic
908641867 1:66232774-66232796 CACTGATGATCTTGACCAGAGGG + Intronic
911128809 1:94368361-94368383 CATTGATGGTCTTTAAAAGTTGG + Intergenic
914225238 1:145714559-145714581 CACTGCTGGCCTTTAGCCCAGGG - Intergenic
917849438 1:179047812-179047834 CTCTGATGTCCTTCAGCAGAAGG + Intronic
918984512 1:191606948-191606970 GACTGAGGTCCTTTAACAAAAGG + Intergenic
920361267 1:205418198-205418220 CACTGGTGGCCTTCAATAAATGG + Intronic
923129487 1:231063046-231063068 GACTGATGTCCTTTAAGAGGAGG + Intergenic
924466870 1:244305970-244305992 CCCTGATGGCCTTGAGCTGAAGG + Intergenic
1062973234 10:1664539-1664561 CACGAATGGCCTTTAGCAGTTGG + Intronic
1067460378 10:46453845-46453867 CACTGATGAACTATAACAGTTGG + Intergenic
1067626812 10:47930758-47930780 CACTGATGAACTATAACAGTTGG - Intergenic
1068145373 10:53062750-53062772 CACTAATGACTTTTAACTGAAGG + Intergenic
1068405438 10:56582412-56582434 CCCTGAAGGCTTTTGACAGAGGG + Intergenic
1068695471 10:59963785-59963807 CAATGAAGGCATTTAACAGCAGG + Intergenic
1069096168 10:64262478-64262500 CACTCATGGCTTTTTGCAGAGGG - Intergenic
1069715093 10:70515480-70515502 GACTGCTGGCCATTCACAGATGG + Intronic
1072685621 10:97534936-97534958 CAATGAGGGCTTTCAACAGAGGG - Intronic
1072777289 10:98211648-98211670 CTCTCATGGCCTTTTACACATGG + Intronic
1075447290 10:122521972-122521994 CACTGATGACCTTTCACAGGAGG - Intergenic
1075978466 10:126717395-126717417 CACTGAAGGCTTTTAAAATATGG - Intergenic
1077911545 11:6576288-6576310 AACTGATGTTCTTTAACAAAAGG + Intronic
1080703606 11:34667434-34667456 CAGTTATGCCCTTTAACACAGGG - Intergenic
1081056244 11:38413654-38413676 CAATGATGGCCTTGAGCTGAAGG + Intergenic
1081497151 11:43623854-43623876 CACTGATGGCTTGTATCTGAGGG - Intronic
1081754812 11:45536991-45537013 CCCTGATGACCTTTATTAGAGGG + Intergenic
1084084940 11:66850690-66850712 CCCTGGTGGCCTGTACCAGAGGG - Exonic
1088100004 11:106144405-106144427 CCCTGATGGCCTTGAGCTGAAGG + Intergenic
1088230809 11:107671714-107671736 CACGGATGACCTTTCTCAGAGGG + Intergenic
1089328122 11:117671325-117671347 GACTGAGGCCCTTTAACTGAGGG - Intronic
1090396181 11:126420175-126420197 CACAGAAGGCCTTTTAAAGATGG + Intronic
1094664090 12:32500996-32501018 CACTGATGGTGTTTACCACAGGG - Intronic
1098441709 12:70525968-70525990 CACTGATTGCCTTAAACACAAGG - Intronic
1098664379 12:73142548-73142570 CATTCATGGCCTTTACCATAGGG - Intergenic
1099610087 12:84857274-84857296 CCCTGATTTCCTTAAACAGAAGG + Intergenic
1102148647 12:110673358-110673380 AACTGAATGCCTTTAACAGCAGG - Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1102956149 12:117060364-117060386 CACAGAGGGACTTTGACAGACGG - Intronic
1102999803 12:117376581-117376603 CAAAGACAGCCTTTAACAGAGGG - Intronic
1105637871 13:22232852-22232874 CTCAGATAGTCTTTAACAGAGGG + Intergenic
1106024801 13:25946590-25946612 CACGGAATGCCTCTAACAGAGGG + Intronic
1106532910 13:30610868-30610890 CACTGGTGGTCTTTAATATATGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1114830928 14:26140606-26140628 CTCTTAGGGCCTTTGACAGATGG - Intergenic
1115490408 14:33952761-33952783 CAGTGATGGCCTTTACCCCAAGG - Intronic
1124099810 15:26682810-26682832 TAGTGATGGCCCTGAACAGAGGG - Intronic
1126463366 15:48937361-48937383 CCCTGATGCCTTTTTACAGATGG + Intronic
1127243326 15:57143211-57143233 CAATAATGTCCTTTAACAAAAGG - Intronic
1127570807 15:60239205-60239227 CACTGATGGTCTTTACCATTTGG - Intergenic
1127746152 15:61976234-61976256 CACTGATACCCTTTATCAGGTGG - Intronic
1131610019 15:93950652-93950674 CACTATTGCCATTTAACAGATGG - Intergenic
1132083600 15:98887945-98887967 CACTGAAGGCCTGTCCCAGAGGG - Intronic
1132812101 16:1805151-1805173 CACAGATGGCCTTTTCCAGCTGG + Intronic
1133121163 16:3609099-3609121 CAGTTGTGGACTTTAACAGAGGG - Exonic
1133918589 16:10131601-10131623 CTCTGAGGGCCTATCACAGAAGG - Intronic
1137461316 16:48666740-48666762 CACTGATGGCCTTTACAATTTGG + Intergenic
1138865710 16:60816889-60816911 CAGTGAAGGTCTTTAAGAGAAGG + Intergenic
1139877662 16:70159288-70159310 AACTGATGTCATTTAACAGGAGG - Exonic
1144314072 17:14042037-14042059 TACTGTTCTCCTTTAACAGACGG + Intergenic
1145124908 17:20292210-20292232 CAAGGAGGGCCTCTAACAGAGGG - Intronic
1150337797 17:64343090-64343112 CACTGTTCTCCTTTTACAGATGG + Intronic
1152218138 17:79046341-79046363 CTGTCATTGCCTTTAACAGAGGG + Intronic
1153140980 18:1972194-1972216 CACTGCTTGCCTTCAACAGTCGG - Intergenic
1157757610 18:50232475-50232497 CACTGATGGCAGTTATCTGAAGG - Intronic
1157831306 18:50859332-50859354 TAATGATGGCCTTTAAAACATGG - Intergenic
1158288637 18:55913782-55913804 CACTGAAGGTTTTTAAAAGAGGG + Intergenic
1158611413 18:58944074-58944096 CACTGCTGCCATTTCACAGATGG - Intronic
1158625234 18:59065381-59065403 CACTGAAGGGCTTTAACTGAAGG - Intergenic
1159078072 18:63703775-63703797 CACTGAAGGACTGCAACAGACGG - Intronic
1161744638 19:6048245-6048267 CAAAGATGGCTTTGAACAGAAGG - Intronic
1163612058 19:18306743-18306765 CACTGATGTCCTTTTACAAAAGG - Exonic
1166468257 19:43054130-43054152 AACTGATGGCCGTTCAGAGAAGG + Intronic
1166474717 19:43113359-43113381 AACTGATGGCCGTTCAGAGAAGG + Intronic
1168513634 19:56993150-56993172 CACACAGGGCCTTTAACAGAGGG + Intergenic
925059122 2:877729-877751 CAGTGAGGGGCTTTCACAGATGG + Intergenic
928711074 2:34006168-34006190 CACTGATGACCGTAACCAGAAGG - Intergenic
929708853 2:44245714-44245736 CACTGAACACCTTTTACAGAGGG - Intergenic
931982847 2:67712695-67712717 CACTGATGGCCTGACACAGCCGG + Intergenic
933068918 2:77833803-77833825 CCCTGATGGCCTTGAGCTGAAGG + Intergenic
938833154 2:135073425-135073447 CACTGATGGCCTTGAGCTGAGGG - Intronic
940917992 2:159278814-159278836 CACTGATGGGCTTGAAAAGGGGG + Intronic
942859861 2:180596624-180596646 CTCTTATGGCCTTCAACTGATGG + Intergenic
943282457 2:185953975-185953997 CTCTGATGGTATTTACCAGAAGG + Intergenic
945999935 2:216473937-216473959 CTCAGATGTCCTTCAACAGATGG + Intronic
1169791934 20:9420184-9420206 CAGTGATGGCCTTTGAAAAAAGG + Intronic
1170431058 20:16277245-16277267 CACCGATTGGCTTTAACACAGGG + Intronic
1172719037 20:36985205-36985227 CAATAATGGCCTTGAACTGAAGG + Intergenic
1183940167 22:41289751-41289773 TAATCATGGCCTTTGACAGATGG + Intergenic
1184223367 22:43114890-43114912 CCCTCCTGCCCTTTAACAGAAGG + Intronic
953798376 3:46002546-46002568 CCCTGATGGCCTTGAGCTGAAGG + Intergenic
956481342 3:69676770-69676792 CACTGCTGGCATCTAGCAGATGG + Intergenic
962779590 3:138699714-138699736 AACTCATGGTCTTTAATAGATGG + Intronic
966087181 3:176082192-176082214 CACTGATTGCCTGTAATAAATGG - Intergenic
969460449 4:7326203-7326225 CACTGAGGGCCTAAGACAGAGGG + Intronic
970005405 4:11406100-11406122 CACTTATGGGATTTAACAAAAGG + Intronic
970855660 4:20647666-20647688 CCCTGATGGCCTTGAGCTGAAGG - Intergenic
972370784 4:38421247-38421269 CACTGATGCCCAAGAACAGAAGG + Intergenic
975536584 4:75457928-75457950 CTCTGTTGGCCTTTCAGAGAGGG + Intergenic
975717310 4:77217344-77217366 CACTGATGGCCTCTGATGGAGGG + Intronic
976469156 4:85407230-85407252 CACTGATGCCATCTAACTGAAGG + Intergenic
976472722 4:85448102-85448124 CACTGATGGCATTTAATTTAGGG + Intergenic
979045832 4:115862080-115862102 CACTGATGAATTTTAAAAGATGG + Intergenic
979822243 4:125189296-125189318 CACTGAAGGCCTTTCTCTGAAGG - Intergenic
981169145 4:141601479-141601501 TACAGATGTCCTTTATCAGATGG + Intergenic
982253139 4:153427313-153427335 GACAGATGGCCTTGAAAAGAAGG - Intergenic
984664838 4:182415130-182415152 TTCAGATGGCCTTTAACAGGAGG + Intronic
986850894 5:11812503-11812525 AACTCATGGCCATTAACAAATGG - Intronic
990737420 5:58879344-58879366 CACCTATGACATTTAACAGACGG - Intergenic
990738507 5:58889408-58889430 CACTTCTGGCCTCTAACAGGAGG + Intergenic
991405728 5:66299666-66299688 CACTGATTGACTTTAAGAAAGGG - Intergenic
991591892 5:68260392-68260414 CACTGCTGGGCTCTAAGAGATGG - Intronic
992505219 5:77380803-77380825 CATTGATAGCATGTAACAGAAGG + Intronic
992534557 5:77685859-77685881 CACAGAAGGGCTTTAGCAGAGGG - Intergenic
995603606 5:113826430-113826452 CACTAAGGGCCTTTAAAAAATGG - Intergenic
1002004080 5:176217463-176217485 CCCTGATGGCCTTAAGCTGAAGG + Intergenic
1002222294 5:177693177-177693199 CCCTGATGGCCTTAAGCTGAAGG - Intergenic
1004239505 6:13907139-13907161 CTCTGATGGCCCTTAACAGATGG + Intergenic
1007199474 6:40094422-40094444 CACTGATGGTCTTTAAAATTTGG + Intergenic
1008041341 6:46802704-46802726 CACAGATGCCCTTTGTCAGATGG + Intronic
1008419017 6:51274880-51274902 AATTGTTGGCCTTGAACAGAAGG - Intergenic
1010095441 6:72037888-72037910 AACTGATGACCTTTAACATTTGG + Intronic
1012270746 6:97207489-97207511 GGGTGATGACCTTTAACAGATGG - Intronic
1019164911 6:170091640-170091662 CTCCGATTGCCTCTAACAGAGGG - Intergenic
1020433601 7:8138366-8138388 CCTTGATGGCCTCTAACACAGGG - Intronic
1020654276 7:10911105-10911127 TATTGATGGCATTTAAGAGAAGG - Intergenic
1021085858 7:16420883-16420905 AAGTTCTGGCCTTTAACAGATGG - Intronic
1022965341 7:35466785-35466807 GACTGTGGGCCTTTAACAGCAGG - Intergenic
1024111063 7:46146580-46146602 CTCTGATGGCCTCTTCCAGAAGG - Intergenic
1028420593 7:90628387-90628409 CAGTAATGGCCTTTAACACTTGG - Intronic
1028954679 7:96675317-96675339 AACTGATGGCCTGTAAAGGAAGG - Intronic
1030879093 7:114853979-114854001 CACTGAAGGCCTTGTAAAGAAGG - Intergenic
1032805096 7:135346230-135346252 CACTGATCACCTTTTCCAGAGGG - Intergenic
1035299676 7:157888600-157888622 CACTGCTGGCCTTTAGATGAGGG - Intronic
1037500731 8:19483266-19483288 CATTGAAGGGCTTAAACAGAAGG - Intronic
1038361687 8:26885856-26885878 CAGTGATGGCTGTTGACAGATGG + Intergenic
1039201622 8:35100629-35100651 GACTGTTGGCCTTTAAGAGCAGG + Intergenic
1039319863 8:36417097-36417119 CCCTGGTGGTCTTTGACAGATGG + Intergenic
1039976423 8:42370160-42370182 CCTTGATGGCCTTCAACTGAGGG - Intronic
1041712292 8:60905684-60905706 CACTGGAAGCCTTTAACACAAGG + Intergenic
1043344763 8:79286579-79286601 CCCTGATAGCCTTGAACTGAAGG - Intergenic
1044866018 8:96572030-96572052 CACTGATGGCCTTTAACAGAAGG - Intronic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1045706846 8:104933939-104933961 CCAAGATGGCCTTTATCAGAAGG - Intronic
1050029611 9:1371815-1371837 AACTGAGGGCCTCTAAGAGAGGG + Intergenic
1050431770 9:5569398-5569420 GACCTATGGTCTTTAACAGAGGG + Intronic
1051140712 9:13976432-13976454 AAATGATGGCCTAGAACAGAAGG + Intergenic
1052016526 9:23474761-23474783 CATGCATGGCCTTTAACACAAGG + Intergenic
1053611297 9:39715771-39715793 CAATGAAGGCCATTAACAGAAGG + Intergenic
1053869338 9:42473819-42473841 CAATGAAGGCCATTAACAGAAGG + Intergenic
1054086957 9:60755389-60755411 CAATGAAGGCCATTAACAGAAGG - Intergenic
1054242222 9:62626621-62626643 CAATGAAGGCCATTAACAGAAGG - Intergenic
1054556347 9:66661137-66661159 CAATGAAGGCCATTAACAGAAGG - Intergenic
1055241199 9:74188479-74188501 CAGTGATGGATTTTAAGAGAAGG - Intergenic
1056967186 9:91174368-91174390 CACAGATGCCCTTTATCAGGTGG + Intergenic
1062147861 9:135000000-135000022 CTCTGATGGCCTTGAGCTGAAGG + Intergenic
1186184306 X:7005173-7005195 AACTGATGGCCATTCAGAGAAGG + Intergenic
1186449144 X:9657486-9657508 CACTGATGGCCTCAGACAGCCGG + Intronic
1189082792 X:37992357-37992379 GCCTGCTGGCCTTTCACAGAGGG + Intronic
1192039563 X:67604156-67604178 CACAGCTGCTCTTTAACAGAAGG + Intronic
1194672566 X:96752646-96752668 CAAGGATGGGCATTAACAGATGG + Intronic
1195731862 X:107976555-107976577 CCCTTATTGCCTTTATCAGAGGG + Intergenic
1201442250 Y:14021002-14021024 CACTGATTGCCTGTAAAAAAAGG - Intergenic