ID: 1044867370

View in Genome Browser
Species Human (GRCh38)
Location 8:96585485-96585507
Sequence TGGCAACAATGAGCAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044867370_1044867379 16 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867379 8:96585524-96585546 GAAATGAGAAGGATGGGGGCGGG No data
1044867370_1044867378 15 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867378 8:96585523-96585545 AGAAATGAGAAGGATGGGGGCGG No data
1044867370_1044867374 9 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867374 8:96585517-96585539 TTGAAGAGAAATGAGAAGGATGG No data
1044867370_1044867373 5 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867373 8:96585513-96585535 TAGATTGAAGAGAAATGAGAAGG No data
1044867370_1044867377 12 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data
1044867370_1044867375 10 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867375 8:96585518-96585540 TGAAGAGAAATGAGAAGGATGGG No data
1044867370_1044867376 11 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867376 8:96585519-96585541 GAAGAGAAATGAGAAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044867370 Original CRISPR TGGCAACAATGAGCAGCCCT GGG (reversed) Intronic
900246112 1:1636899-1636921 TGGCACCAAGCAGCAGCTCTGGG + Exonic
900257335 1:1704041-1704063 TGGCACCAAGCAGCAGCTCTGGG + Exonic
900461581 1:2804545-2804567 TGGCAACAATTTGGGGCCCTTGG + Intergenic
900793495 1:4694077-4694099 TGGCCACCAGGAGCAGCCCTGGG - Intronic
905519528 1:38587216-38587238 GGGCAGCCAAGAGCAGCCCTGGG - Intergenic
906690603 1:47790426-47790448 TGACAACCTTGAGCAGGCCTGGG - Intronic
912127602 1:106558949-106558971 TGGCTACTATGAGCAACCATAGG + Intergenic
912552442 1:110492836-110492858 TGCCAGCAATGGGCAGGCCTTGG + Intergenic
913199902 1:116487538-116487560 TGTCAAAAATGAGCAGGCTTAGG - Intergenic
914799667 1:150951271-150951293 TGGCCACACTGAGCAACCTTGGG + Intronic
915361304 1:155287839-155287861 TGGCATCATGGAGCAGCACTTGG + Exonic
916218047 1:162415310-162415332 TGGTAGCAATGAGCACACCTAGG + Intergenic
917122896 1:171659865-171659887 TGGAAACCATGAGCAGCTGTGGG + Intergenic
922111084 1:222556299-222556321 AGGCAGAAATGAGCAGACCTGGG + Intergenic
1064697459 10:17982703-17982725 TGGCACCTAGGAGCATCCCTGGG + Intronic
1064710032 10:18113573-18113595 TGGCAACAAAGGGCAGACCCAGG + Intergenic
1065361219 10:24890807-24890829 TGGCAGCTTTGGGCAGCCCTTGG + Intronic
1072742568 10:97918300-97918322 TTGCATCCAGGAGCAGCCCTGGG + Intronic
1073473386 10:103737756-103737778 TGGCTCCAGTGAGCAGCCTTTGG + Intronic
1073624728 10:105085232-105085254 TGCCAACATTGAAAAGCCCTAGG + Intronic
1074072654 10:110087959-110087981 TGGGAACCATGAGAAGCCCGGGG - Intronic
1075085583 10:119412398-119412420 TGCCAACATCCAGCAGCCCTCGG - Intronic
1082160345 11:48882795-48882817 TGGCAAAAATGAGAAGTGCTGGG - Intergenic
1082162021 11:48897611-48897633 TGGCAAAAATGAGAAGTGCTGGG + Intergenic
1082235943 11:49820594-49820616 TGGCAAAAATGAGAAGTGCTGGG - Intergenic
1082239402 11:49855150-49855172 TGGCAAAAATGAGAAGTGCTGGG - Intergenic
1082609452 11:55280522-55280544 TGGCAAAAATGAGAAGTGCTGGG - Intergenic
1082657239 11:55870011-55870033 TGGCAAAAATGAGAAGTGCTGGG + Intergenic
1083666327 11:64276796-64276818 TGGCAAGAGTGGGCAGGCCTGGG - Intronic
1084538063 11:69769490-69769512 TGGCACCCCTCAGCAGCCCTTGG + Intergenic
1085053930 11:73393338-73393360 GGGCCACGATGATCAGCCCTGGG - Intronic
1087169077 11:95032080-95032102 TGGGAAAGATGAGCAGCCCTAGG + Intergenic
1087172018 11:95058852-95058874 TGAGAAAGATGAGCAGCCCTAGG + Intergenic
1088140537 11:106610738-106610760 TGGCAACAATGAGAAGCAACTGG - Intergenic
1089164824 11:116467813-116467835 TGGCAAGTGTGAGCACCCCTGGG + Intergenic
1092959128 12:13579178-13579200 TGGCAACAATAAGCTGCTCGTGG - Intronic
1094424195 12:30301849-30301871 TGGCCACTCTGGGCAGCCCTTGG - Intergenic
1094524870 12:31224907-31224929 TCCCAGCAATGAGCTGCCCTGGG - Intergenic
1099567120 12:84265859-84265881 TGGCAACAATCCTCAGCCTTAGG - Intergenic
1104226732 12:126842174-126842196 AGGCACCAGTGAGCAGCCATTGG + Intergenic
1104725969 12:131075948-131075970 TGCCACCTCTGAGCAGCCCTGGG + Intronic
1106250238 13:27977333-27977355 TAGTAACATTGAGCAGCGCTGGG - Intergenic
1109644582 13:65236919-65236941 TTTCAGCAAGGAGCAGCCCTGGG + Intergenic
1111663361 13:91238181-91238203 TGGTAACAATGAGCAGTTATGGG - Intergenic
1112616215 13:101008356-101008378 TGGCAACTATGAGCCCTCCTGGG - Intergenic
1113758260 13:112829232-112829254 TGGCAGCATTGACCAGCACTGGG + Intronic
1113900940 13:113797538-113797560 AGGTAACAATGAGTAGCCCAAGG - Intronic
1115191449 14:30751611-30751633 TGGGAACAGTTAGCAGCTCTGGG - Intergenic
1117841259 14:59862773-59862795 AGGGAACACTGAGTAGCCCTTGG - Intronic
1118322698 14:64762709-64762731 TGGCATCTGTGAGCTGCCCTTGG + Intronic
1121518444 14:94569600-94569622 TGGAACAGATGAGCAGCCCTGGG - Exonic
1121782809 14:96633011-96633033 TGACAGCACTGGGCAGCCCTGGG - Intergenic
1122617312 14:103028444-103028466 TGTCAACAATGAGCAGTGCCAGG + Intronic
1124476886 15:30042762-30042784 TGGCAACATTTAGCAGCACAGGG + Intergenic
1125443708 15:39730801-39730823 TGGCAGCAATGAGCATCTCGTGG + Intronic
1125475784 15:40047344-40047366 TGGAGACACTGAGCTGCCCTTGG - Intergenic
1126803576 15:52322452-52322474 TGGCCACAAGGAGCAGAGCTGGG - Intronic
1129687086 15:77692701-77692723 GGGCAGCAGGGAGCAGCCCTGGG + Intronic
1130371890 15:83291734-83291756 TAGCAAAAATCAGCAGTCCTGGG - Intergenic
1134853346 16:17499879-17499901 AGGCAATAGTGAGCATCCCTGGG - Intergenic
1137802075 16:51270720-51270742 TGTCAATAATGAGCTGCCTTTGG + Intergenic
1138753155 16:59448546-59448568 TGGCAACAATGTGGAGAACTTGG - Intergenic
1139472672 16:67186662-67186684 AGGCAGAAATGAGCAGCCATCGG + Intronic
1139698374 16:68691796-68691818 TGGCAACAAAGAGCAGCTGACGG + Exonic
1140664500 16:77215072-77215094 TGGCAACACTGAGCTCCCCCAGG - Intergenic
1141205877 16:81932795-81932817 TGGGAAGAATTAGGAGCCCTAGG - Intronic
1143673714 17:8415013-8415035 TGACAACATTCAGCAGTCCTGGG - Intronic
1150923623 17:69509639-69509661 TGGCAAGAATGTCCAGTCCTAGG + Intronic
1152023891 17:77796541-77796563 TGGAAAGAATGAGAAGCACTCGG + Intergenic
1152359003 17:79821641-79821663 TGGTAACAATGAGCTGGCCTTGG + Intergenic
1152613769 17:81328752-81328774 TGGCCACACTGAGCACCCCTGGG + Intronic
1153374373 18:4358750-4358772 TGGCCACAAAGCTCAGCCCTAGG - Intronic
1153959331 18:10127411-10127433 AGCCAACAATGAGGAACCCTGGG - Intergenic
1157339689 18:46768315-46768337 TGGAAACAATGAACATCCCTCGG - Intergenic
1157365780 18:47062989-47063011 TGGCATCTGTGAGCAGCCCTTGG - Exonic
1157394524 18:47330779-47330801 TGGGGCCAATGGGCAGCCCTGGG - Intergenic
1157809829 18:50687102-50687124 TGGCAAGAATGAACAACTCTGGG - Intronic
1165663651 19:37605708-37605730 TGGCAACAATGTGGAGCTATTGG - Intronic
1165791775 19:38496906-38496928 TGACAACAATGAGCTGGCCTTGG + Exonic
930054842 2:47244051-47244073 TGGAAACACTGAGCAGGCTTGGG - Intergenic
932968783 2:76512855-76512877 TGGCAAAAATGGGCAGCAATGGG - Intergenic
933297205 2:80504251-80504273 TGGGAACAAAGAGTAGCCCCTGG - Intronic
936977148 2:118231800-118231822 TGGCAACAAGGAGTTGCACTGGG - Intergenic
937455088 2:122034341-122034363 TGGAAACAATGAGGAACCTTGGG - Intergenic
937671851 2:124546563-124546585 TGCCCACAATGAGCAGCCCAAGG - Intronic
945790147 2:214294255-214294277 TGGCAGGAATGTGGAGCCCTGGG + Intronic
946114382 2:217448648-217448670 TGGCAGCAAGGGGCAGCCCAGGG + Intronic
946809487 2:223508392-223508414 TGGCAACATGGAGGAGTCCTAGG + Intergenic
946943387 2:224794117-224794139 GGACAAGAATGAGAAGCCCTTGG - Intronic
1170537878 20:17359356-17359378 TTGCAATAATGAACAACCCTCGG + Intronic
1172724878 20:37031561-37031583 TGGCAACGATGAGAAGAACTTGG + Intronic
1172798432 20:37559434-37559456 AGTCAACAATTGGCAGCCCTTGG + Intergenic
1173317489 20:41958215-41958237 GGGCATGAATGAGCAGCTCTAGG - Intergenic
1173415440 20:42850829-42850851 TGTCTTCAAAGAGCAGCCCTTGG + Intronic
1178639040 21:34331197-34331219 TGGCCACACTGAGGAGCCCAAGG - Intergenic
1178728093 21:35073078-35073100 TGGCAGCCATGAGCAGGACTGGG - Intronic
1179170505 21:38969382-38969404 TGGCAACCCTGGGCAGCCCTGGG + Intergenic
1181555706 22:23670637-23670659 GGCCAACAATGAGCAGCACCAGG + Intergenic
1184380934 22:44144389-44144411 TGGCAGCAATAAGCTGCCCCTGG - Intronic
949484805 3:4527728-4527750 TGGCTATAATGAGCCGCTCTTGG + Intronic
949917199 3:8974323-8974345 TAAGAACAATGAGAAGCCCTTGG - Intergenic
953576873 3:44119820-44119842 TTGCAGCACAGAGCAGCCCTGGG + Intergenic
955603005 3:60668405-60668427 TGGCAACAAGAAGCAGCTCAGGG - Intronic
961626632 3:128268722-128268744 CGGCAACCATGGGCACCCCTTGG - Intronic
964023730 3:152045996-152046018 TGGCAATCATGAGAAGACCTTGG - Intergenic
965625277 3:170678443-170678465 TGGCAACAATGACTTGCCCAGGG + Intronic
971169097 4:24214939-24214961 TGGTTACAATGAGCAGCACAAGG - Intergenic
977061086 4:92257306-92257328 TTACAACACTGAGCACCCCTGGG + Intergenic
979466191 4:121041288-121041310 TGGAATCAATGAGCAACTCTGGG - Intronic
982485443 4:155959695-155959717 GGGCAACAATGACCCGGCCTGGG + Intergenic
983753174 4:171301676-171301698 TGGTAACAATGAGAAGCAGTGGG + Intergenic
984799788 4:183704126-183704148 TGGTAACATGCAGCAGCCCTGGG + Intronic
986733725 5:10653236-10653258 TGGCAAAAATGAGAAGTTCTGGG - Intergenic
988674541 5:33418330-33418352 TGGAAACAATGAGAAAACCTTGG - Intergenic
990334366 5:54757470-54757492 TGGCAGCATTGAGCAGTCCTGGG + Intergenic
991096887 5:62749156-62749178 TGGCAACAGTGAGAGGGCCTTGG - Intergenic
993786693 5:92147614-92147636 GTGCAACTCTGAGCAGCCCTGGG - Intergenic
996791954 5:127302950-127302972 TGGCAGAAATGTACAGCCCTGGG + Intronic
999127250 5:149254749-149254771 TGGCTTCACTGAGCTGCCCTGGG - Intronic
999187465 5:149723058-149723080 TGGCATCAATGTGCTCCCCTGGG + Intergenic
1002796334 6:473950-473972 TGGGAACTGAGAGCAGCCCTGGG - Intergenic
1004804849 6:19191808-19191830 TGGCAACATTGTGTAGCCCTAGG - Intergenic
1007119622 6:39369231-39369253 TGGCAGCACTGAGCACCCGTCGG - Intronic
1013314129 6:108924794-108924816 TGGCAGCAGTGAGCAGCTATGGG + Intronic
1015526115 6:134176276-134176298 TGGCAAAACTAAGAAGCCCTGGG - Intronic
1017112688 6:150947768-150947790 TGGCCACATAGAGCAGCCCAAGG + Intronic
1018433783 6:163743829-163743851 AGGCAAGACTGAGCAGGCCTGGG - Intergenic
1018632560 6:165833739-165833761 TGGCAGGAAAGACCAGCCCTGGG + Intronic
1019750519 7:2726265-2726287 TGGCCACAGTGAGAAGACCTTGG + Intronic
1022173398 7:27850725-27850747 TCACAGCAAAGAGCAGCCCTGGG + Intronic
1023839902 7:44090935-44090957 TAGCACCAAGGAGAAGCCCTGGG + Intergenic
1028510203 7:91616774-91616796 TGGCAAGAATGTGCAGCAATGGG - Intergenic
1029365594 7:100114161-100114183 TAGCAACACTGTGCTGCCCTCGG - Exonic
1035821941 8:2602446-2602468 GGGAAACAATGTGAAGCCCTAGG + Intergenic
1040416298 8:47198782-47198804 AGGCACCAATGCCCAGCCCTTGG + Intergenic
1041040311 8:53840043-53840065 TGGCAAGTAGGAGCAGCCTTGGG - Intronic
1042567462 8:70126859-70126881 CAGCAACTATGAGCAACCCTCGG - Exonic
1042699458 8:71596123-71596145 TGGCAGTAGAGAGCAGCCCTCGG + Intergenic
1044867370 8:96585485-96585507 TGGCAACAATGAGCAGCCCTGGG - Intronic
1047538703 8:125743359-125743381 TGGCCACAATGAGGTGCCCCAGG - Intergenic
1049433327 8:142575240-142575262 TGTCATCAATGAGCAGACCGAGG + Intergenic
1050888346 9:10792644-10792666 TGGCAAGAATGTGCAGACATTGG - Intergenic
1053053236 9:34978295-34978317 TTGCCACAAGGAGAAGCCCTGGG + Exonic
1054831060 9:69625215-69625237 TGTCAAAAAGGAGCAGTCCTGGG - Intronic
1055135742 9:72826959-72826981 TGACAGCAATGACCAGCCCAGGG - Exonic
1055854611 9:80670507-80670529 TGGCAGAAATGCGGAGCCCTGGG + Intergenic
1056264189 9:84879706-84879728 TGGAAAGGATGAGCAGCACTGGG - Intronic
1057635039 9:96756771-96756793 TGGCAAAAGGGGGCAGCCCTTGG - Exonic
1057967444 9:99517883-99517905 TGGCAATCCTGGGCAGCCCTTGG - Intergenic
1058748939 9:108019912-108019934 TGTGAACAATGATCAGCCATGGG - Intergenic
1061009307 9:127945796-127945818 GGGCGACAGTGAGCAGCACTGGG - Intronic
1061181968 9:129029627-129029649 TGGAGAGAATGAGCTGCCCTGGG + Intergenic
1061484906 9:130915269-130915291 CGGCACCAAGGAGGAGCCCTGGG - Intronic
1186152889 X:6693926-6693948 GGGCAACAATGAACATCCCACGG - Intergenic
1186556792 X:10568558-10568580 TGGCAACAGTGACAAGCCCGTGG - Intronic
1189366739 X:40394670-40394692 TTGCCACAATGTGCTGCCCTGGG - Intergenic
1190740797 X:53287672-53287694 TGGCTTTAATTAGCAGCCCTGGG - Intronic
1191083235 X:56536797-56536819 TGGCAACATGGATCAGCCCAGGG + Intergenic
1192837223 X:74813424-74813446 TGGCAACTGTGGGCAGCTCTTGG - Intronic
1194426262 X:93742193-93742215 TGGCAAGAATGAGGAGCAATTGG + Intergenic
1197140852 X:123115985-123116007 TGTCAACAATGGGCAGGCCCTGG + Intergenic
1199137678 X:144272324-144272346 TGGCAACACTGAGCTGCTCAGGG + Intergenic