ID: 1044867371

View in Genome Browser
Species Human (GRCh38)
Location 8:96585486-96585508
Sequence TTGGCAACAATGAGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044867371_1044867376 10 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867376 8:96585519-96585541 GAAGAGAAATGAGAAGGATGGGG No data
1044867371_1044867373 4 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867373 8:96585513-96585535 TAGATTGAAGAGAAATGAGAAGG No data
1044867371_1044867378 14 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867378 8:96585523-96585545 AGAAATGAGAAGGATGGGGGCGG No data
1044867371_1044867375 9 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867375 8:96585518-96585540 TGAAGAGAAATGAGAAGGATGGG No data
1044867371_1044867374 8 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867374 8:96585517-96585539 TTGAAGAGAAATGAGAAGGATGG No data
1044867371_1044867379 15 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867379 8:96585524-96585546 GAAATGAGAAGGATGGGGGCGGG No data
1044867371_1044867377 11 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044867371 Original CRISPR TTGGCAACAATGAGCAGCCC TGG (reversed) Intronic
900246111 1:1636898-1636920 TTGGCACCAAGCAGCAGCTCTGG + Exonic
900257334 1:1704040-1704062 TTGGCACCAAGCAGCAGCTCTGG + Exonic
900793496 1:4694078-4694100 GTGGCCACCAGGAGCAGCCCTGG - Intronic
904839987 1:33366359-33366381 TTGCCTACAATGGGCAGCACAGG + Intronic
905994373 1:42368273-42368295 TTGGCCACAATGACTAGTCCAGG + Intergenic
906952931 1:50349262-50349284 TTGGCAGCATTCTGCAGCCCTGG + Intergenic
909395673 1:75168520-75168542 TTGAAAACAATGACCAGGCCAGG - Intergenic
910568907 1:88678459-88678481 TTGGGAACAATAAGCAGAACGGG + Intergenic
917084584 1:171292783-171292805 TTGGCAACTATGAAAATCCCAGG - Intergenic
923031334 1:230251267-230251289 TTAACAACACTCAGCAGCCCAGG - Intronic
1064786010 10:18895285-18895307 TTGGCAACAATGTGTAATCCTGG - Intergenic
1067739243 10:48882046-48882068 TTGGGAACAATCTGCAGACCAGG + Intronic
1068432048 10:56946538-56946560 TTGGCAACATTTAACAGCCTAGG + Intergenic
1070009230 10:72456094-72456116 GTGGCAACTATGAACAGCACCGG + Intronic
1070830639 10:79416016-79416038 TTATCAAAAATGCGCAGCCCGGG - Intronic
1072742567 10:97918299-97918321 TTTGCATCCAGGAGCAGCCCTGG + Intronic
1072933755 10:99692199-99692221 GTGCCAACGATGAGAAGCCCTGG - Intronic
1074072655 10:110087960-110087982 CTGGGAACCATGAGAAGCCCGGG - Intronic
1075664519 10:124221136-124221158 ATGGCAGCTCTGAGCAGCCCAGG - Intergenic
1076342465 10:129759266-129759288 TTACCAGCAATTAGCAGCCCTGG + Exonic
1076531487 10:131147980-131148002 TTGGCAACCCTGGGCAGACCAGG + Intronic
1076680462 10:132168913-132168935 TTGCACACAAGGAGCAGCCCAGG + Exonic
1077828254 11:5834151-5834173 TTGGTCACACAGAGCAGCCCTGG - Intronic
1078182703 11:9026075-9026097 TTGGCAAGCAGCAGCAGCCCAGG + Intronic
1078397337 11:10992741-10992763 TTGGCAGAAATGAGGAGCCTGGG - Intergenic
1079259190 11:18861638-18861660 TTGTCCATAATGAGGAGCCCTGG - Intergenic
1085053931 11:73393339-73393361 TGGGCCACGATGATCAGCCCTGG - Intronic
1086600756 11:88630488-88630510 TTTGCAACATTGGGCAACCCTGG - Intronic
1090356155 11:126141623-126141645 GTGGCACCGAGGAGCAGCCCAGG + Intergenic
1094524871 12:31224908-31224930 TTCCCAGCAATGAGCTGCCCTGG - Intergenic
1094753568 12:33440068-33440090 TGGGCAACGATGAGCATCCCCGG - Intergenic
1095395008 12:41752453-41752475 TTGCCAACAAAGAAAAGCCCTGG - Intergenic
1097031482 12:56093345-56093367 TGATCAACAATGAGAAGCCCCGG - Exonic
1097491984 12:60282422-60282444 TGGGCAACCATGGGCAGGCCTGG + Intergenic
1099859466 12:88208983-88209005 TTGGCTGCAATGAGCTGCACAGG - Intergenic
1104725992 12:131076070-131076092 CTGGCACCCAGGAGCAGCCCAGG + Intronic
1105937772 13:25117768-25117790 TTGGGACCAAGGAGCAGCCTCGG - Intergenic
1106576187 13:30977903-30977925 CTGGGACCAGTGAGCAGCCCAGG - Intergenic
1107408124 13:40134162-40134184 TTGGCACCCATTAGCAACCCAGG - Intergenic
1109644581 13:65236918-65236940 TTTTCAGCAAGGAGCAGCCCTGG + Intergenic
1110318970 13:74138401-74138423 TTGGCAATAATGTGCAGCAAAGG + Intergenic
1112109439 13:96279011-96279033 GAGTGAACAATGAGCAGCCCAGG + Intronic
1113489355 13:110679175-110679197 ATGGCAACAATGAGTATCCATGG + Intronic
1116151259 14:41145228-41145250 TGGGCAACCATGGGCAGGCCTGG + Intergenic
1117731564 14:58727579-58727601 AGGATAACAATGAGCAGCCCAGG + Intergenic
1117992108 14:61444278-61444300 TGGGAAAAAATTAGCAGCCCTGG + Intronic
1119506426 14:75176844-75176866 ATGGCAAGTATGGGCAGCCCTGG + Intergenic
1119780953 14:77276577-77276599 CTGGGAACACTGAGCAGCCCAGG + Exonic
1121333700 14:93063861-93063883 TGGGCTTCTATGAGCAGCCCAGG - Intronic
1121518445 14:94569601-94569623 TTGGAACAGATGAGCAGCCCTGG - Exonic
1124476885 15:30042761-30042783 ATGGCAACATTTAGCAGCACAGG + Intergenic
1124998318 15:34745682-34745704 TTGGAAACAATGATGATCCCAGG - Intergenic
1126803577 15:52322453-52322475 TTGGCCACAAGGAGCAGAGCTGG - Intronic
1126870155 15:52978709-52978731 TTGGCTATCATGGGCAGCCCTGG + Intergenic
1128634246 15:69293040-69293062 TGGGCAACAAGGAGAAACCCAGG + Intergenic
1130730717 15:86489147-86489169 TTGGCTACAGTGATAAGCCCTGG + Intronic
1132631351 16:919196-919218 TTGGCCACACTGAGCACACCTGG - Intronic
1133865516 16:9638306-9638328 TTGAGAACGCTGAGCAGCCCTGG - Intergenic
1138496422 16:57411891-57411913 TTGGCACCAAAGAGGTGCCCAGG + Intronic
1140849879 16:78925252-78925274 GTGGCAGCAATGATCAGCCTTGG - Intronic
1140917268 16:79505664-79505686 TGGGCAACACTTAACAGCCCTGG - Intergenic
1141519614 16:84569408-84569430 TTGCCAAGAATGATGAGCCCAGG + Intronic
1142650211 17:1344831-1344853 TAGGCAAGAATGAGCAGCCACGG + Exonic
1151303608 17:73247911-73247933 GTGGCAGCAATGAGCAGACAAGG - Exonic
1151354281 17:73549299-73549321 TCTTCAACAGTGAGCAGCCCAGG - Intronic
1152613768 17:81328751-81328773 ATGGCCACACTGAGCACCCCTGG + Intronic
1155226379 18:23733071-23733093 TTGGGACTAATCAGCAGCCCAGG + Intronic
1156091004 18:33469178-33469200 TTGCCAAAAATCACCAGCCCAGG - Intergenic
1160891502 19:1381016-1381038 TTGGTCACACAGAGCAGCCCCGG + Intergenic
1161003393 19:1922528-1922550 TTAGAAACAATGAGGAGGCCGGG - Intronic
1162185930 19:8904787-8904809 TAGGCACCAATGAGCAGGGCTGG + Intronic
1163082649 19:14954668-14954690 TTGAGAACATTGAGCAGGCCAGG + Intronic
1163627543 19:18398738-18398760 CTGGCAAGAATGAGCATCTCTGG - Intergenic
1164142593 19:22486420-22486442 TTGGCTAAAACCAGCAGCCCAGG - Intronic
1165130063 19:33626368-33626390 TTGACACCAAGAAGCAGCCCTGG + Intronic
925361263 2:3282195-3282217 TCGGCAACCATCACCAGCCCCGG + Intronic
926753980 2:16221454-16221476 TTGGGAAGAATGTGCAGCACAGG - Intergenic
930675378 2:54195550-54195572 ATGGCAACCATGAGGTGCCCTGG - Intronic
931876835 2:66522697-66522719 ATGGCAACAGTCAGAAGCCCTGG - Intronic
931902293 2:66803341-66803363 GTGGAAATCATGAGCAGCCCAGG + Intergenic
932018543 2:68058820-68058842 TTAGCAACATTCAGCAGGCCTGG + Intronic
937129202 2:119494563-119494585 GTGGCAATGATGAGCATCCCTGG - Intronic
939135390 2:138287420-138287442 TAGGCAAGAATGAGCAGCCATGG + Intergenic
939966839 2:148618644-148618666 TTTGCTATAATGAGCAGCCTTGG + Intergenic
946039359 2:216770642-216770664 AAGGCAGCAATGAGCAGGCCAGG - Intergenic
946114381 2:217448647-217448669 ATGGCAGCAAGGGGCAGCCCAGG + Intronic
1168984152 20:2033440-2033462 CTGGGGAAAATGAGCAGCCCCGG + Intergenic
1169204315 20:3731804-3731826 TGGGCAACAAAGACCAGCCTGGG - Intergenic
1171299155 20:24044157-24044179 TTGGCAAGAATCAGGACCCCGGG - Intergenic
1173613610 20:44388688-44388710 TTGGCCACGAGGAGGAGCCCAGG + Intronic
1174121927 20:48272267-48272289 TCGCCAACAATGAGCACCCCTGG + Intergenic
1174164959 20:48577996-48578018 TGTGCAATAAGGAGCAGCCCAGG - Intergenic
1175115510 20:56679119-56679141 TCTGCCACAATGTGCAGCCCAGG + Intergenic
1177703316 21:24666987-24667009 TAAGCAACACAGAGCAGCCCAGG + Intergenic
1178849202 21:36199084-36199106 TTGGCAACAAGGAGTACCTCAGG - Exonic
1179044363 21:37831522-37831544 TTGGCAAGCATGAGCAGACAGGG + Intronic
1179170504 21:38969381-38969403 GTGGCAACCCTGGGCAGCCCTGG + Intergenic
1181425058 22:22830463-22830485 TGGGCAACATGGAGCAGCTCAGG + Intronic
1181566618 22:23742676-23742698 TTGGCAACTGTGAGCAGTCATGG - Exonic
1184385414 22:44171546-44171568 TCAGCCAAAATGAGCAGCCCTGG + Intronic
950809290 3:15635977-15635999 ATGGCAAGTATGAGAAGCCCAGG + Intronic
955603006 3:60668406-60668428 CTGGCAACAAGAAGCAGCTCAGG - Intronic
957290268 3:78269552-78269574 GTGGCAAGAATGTGGAGCCCTGG + Intergenic
960093645 3:113666881-113666903 TTAGCAACAATAAGTAGTCCGGG - Intronic
960616629 3:119601310-119601332 ATGGGAACCATGAGCAGCCCAGG + Intronic
965365507 3:167794143-167794165 TTAGAAACAATGAAAAGCCCTGG - Intronic
965625276 3:170678442-170678464 CTGGCAACAATGACTTGCCCAGG + Intronic
965673645 3:171172830-171172852 TTGGAAACACTGAGAAGTCCAGG - Intronic
970345505 4:15148830-15148852 TTAGCAACACCGAGAAGCCCTGG + Intergenic
970880888 4:20928905-20928927 TTTGCAACAAAGAAAAGCCCAGG + Intronic
971393483 4:26207240-26207262 TTGTCAGCAATGAGCAAGCCGGG + Intronic
973642338 4:52915880-52915902 TTGTCAACAGTGCCCAGCCCTGG - Intronic
976700798 4:87966715-87966737 TGGGCAACCATGGGCAGGCCTGG - Intergenic
979004725 4:115278662-115278684 TTTCCAACAATGAAAAGCCCAGG + Intergenic
980740740 4:136946911-136946933 TGGGAAACCATGGGCAGCCCTGG - Intergenic
981205984 4:142041034-142041056 TTGGGAGCTAAGAGCAGCCCTGG - Intronic
981809100 4:148753055-148753077 TTGGAAAAAATGCCCAGCCCTGG - Intergenic
982845183 4:160243607-160243629 TTGCCACCAATAAGAAGCCCAGG - Intergenic
982957711 4:161792524-161792546 TTGGCAGCCATGGGCAGACCAGG - Intronic
985257243 4:188082356-188082378 TTGGAAAGAATAAACAGCCCAGG + Intergenic
985507644 5:292991-293013 ATGCCACCAATGAGAAGCCCAGG - Intronic
985884224 5:2663906-2663928 TAGGCAGAGATGAGCAGCCCAGG - Intergenic
985909092 5:2864945-2864967 CTGGCACCAATGAGCATCCCTGG - Intergenic
988793514 5:34631134-34631156 TTGGAAGCAGAGAGCAGCCCTGG + Intergenic
990334365 5:54757469-54757491 GTGGCAGCATTGAGCAGTCCTGG + Intergenic
993786694 5:92147615-92147637 TGTGCAACTCTGAGCAGCCCTGG - Intergenic
994891316 5:105639826-105639848 TGGGCAGCAATGGGCAGGCCTGG - Intergenic
998480536 5:142459241-142459263 TGGGCAGCCATGAGCAGGCCTGG + Intergenic
999187464 5:149723057-149723079 TTGGCATCAATGTGCTCCCCTGG + Intergenic
1002840205 6:898936-898958 CTGGCAACAGTGAGCACACCTGG + Intergenic
1003404752 6:5819182-5819204 GTGGTTACAATGGGCAGCCCAGG - Intergenic
1005049381 6:21669773-21669795 TTGGTAACAAACAGAAGCCCAGG - Intergenic
1005315814 6:24601860-24601882 TTGTCTACAATAAGCAGCCTAGG - Intronic
1006211203 6:32396470-32396492 TTAGAAACCATGAGCATCCCAGG + Intronic
1008686434 6:53930614-53930636 TCAGCCACACTGAGCAGCCCTGG - Intronic
1009514221 6:64594228-64594250 TTCGCAACAAAGAAAAGCCCAGG + Intronic
1009747923 6:67843975-67843997 TTCTCAACAGTGAGTAGCCCAGG + Intergenic
1014608207 6:123505548-123505570 TTGGCAACAATAAGCTAACCTGG + Intronic
1016207285 6:141484474-141484496 ATGGCAACAAAGAGCTGGCCGGG - Intergenic
1017373009 6:153735585-153735607 TGGGCAACCATGGGCAGGCCTGG + Intergenic
1018962178 6:168456839-168456861 TTGCCCACATGGAGCAGCCCAGG - Intronic
1019195037 6:170276310-170276332 TTGGCTCTACTGAGCAGCCCTGG - Intergenic
1021772207 7:24016117-24016139 TTGGCAACAATGTGGAGACAAGG + Intergenic
1023839901 7:44090934-44090956 TTAGCACCAAGGAGAAGCCCTGG + Intergenic
1024373012 7:48607746-48607768 TTGGCAACAATAACCACCACAGG - Intronic
1027405645 7:77857107-77857129 TTGGCCACAGTGATCAGTCCAGG + Intronic
1027660721 7:80985453-80985475 TTGGAATCAATGAGGAGCACAGG + Intergenic
1028129840 7:87157371-87157393 GTGGCAATCATGAGCAGCACAGG - Intronic
1028510204 7:91616775-91616797 TTGGCAAGAATGTGCAGCAATGG - Intergenic
1030379760 7:108799050-108799072 TTTGCAACACTGAGCAACCCAGG - Intergenic
1031565349 7:123289573-123289595 TTCCCAACAATGAAAAGCCCAGG - Intergenic
1031592835 7:123614177-123614199 TTGGCATCAATCAGAAGCTCAGG + Intronic
1031797904 7:126200406-126200428 TTGGCATCAGTGAGGAGTCCTGG + Intergenic
1032436406 7:131904502-131904524 TTGGCAACCCTGTTCAGCCCAGG - Intergenic
1034763203 7:153693105-153693127 TTGGAAAGAATAAGCAGGCCAGG - Intergenic
1035002499 7:155624379-155624401 TTGGAACAAATGAGCTGCCCTGG - Intronic
1035016074 7:155767319-155767341 ATGGCAACAATGGGCACCACAGG - Intronic
1036671361 8:10790635-10790657 TTGCCACCACTGAGCAGCTCAGG + Intronic
1037497250 8:19451669-19451691 TTCCCAAGAAAGAGCAGCCCTGG - Intronic
1038659099 8:29481403-29481425 TAGACAACAATGTGCAGCCTGGG - Intergenic
1039324917 8:36474606-36474628 TTGGCCACATAGACCAGCCCTGG + Intergenic
1042483552 8:69328687-69328709 ATGCCAACAATGAGAGGCCCAGG - Intergenic
1044867371 8:96585486-96585508 TTGGCAACAATGAGCAGCCCTGG - Intronic
1045463189 8:102444439-102444461 TTAACATCAATGAGCAACCCAGG + Intergenic
1047634006 8:126739968-126739990 TTGCCAACAATAAAAAGCCCAGG - Intergenic
1047649820 8:126908384-126908406 TTGGCAGCAATAACCAGCACAGG + Intergenic
1048967347 8:139624534-139624556 TTGGCAAAGCTGAGCAGGCCAGG - Intronic
1053431948 9:38047923-38047945 CTGGCACCAATGAGCAAGCCTGG + Intronic
1054831061 9:69625216-69625238 TTGTCAAAAAGGAGCAGTCCTGG - Intronic
1055135743 9:72826960-72826982 ATGACAGCAATGACCAGCCCAGG - Exonic
1056264190 9:84879707-84879729 TTGGAAAGGATGAGCAGCACTGG - Intronic
1061338610 9:129960874-129960896 TGTGCAATAATGAGCTGCCCAGG + Intronic
1061484907 9:130915270-130915292 TCGGCACCAAGGAGGAGCCCTGG - Intronic
1061940262 9:133880178-133880200 TTGGCACTCACGAGCAGCCCTGG + Intronic
1062168571 9:135121659-135121681 TTGGCAACCCTGAGGGGCCCAGG + Intergenic
1186909086 X:14142362-14142384 CTGGCAACAGCGAGCAGCCAGGG - Intergenic
1188889853 X:35596281-35596303 TTGCCAACAAAGAAAAGCCCAGG + Intergenic
1191083234 X:56536796-56536818 ATGGCAACATGGATCAGCCCAGG + Intergenic
1194350088 X:92816395-92816417 TGGGCAACATGGAGCAGCTCAGG + Intergenic
1199137677 X:144272323-144272345 CTGGCAACACTGAGCTGCTCAGG + Intergenic
1200658408 Y:5933037-5933059 TGGGCAACATGGAGCAGCTCAGG + Intergenic