ID: 1044867372

View in Genome Browser
Species Human (GRCh38)
Location 8:96585505-96585527
Sequence TTTCTCTTCAATCTAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044867372_1044867383 29 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867383 8:96585557-96585579 TTTATGTGTTGTGATGCTTGGGG No data
1044867372_1044867378 -5 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867378 8:96585523-96585545 AGAAATGAGAAGGATGGGGGCGG No data
1044867372_1044867375 -10 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867375 8:96585518-96585540 TGAAGAGAAATGAGAAGGATGGG No data
1044867372_1044867376 -9 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867376 8:96585519-96585541 GAAGAGAAATGAGAAGGATGGGG No data
1044867372_1044867377 -8 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data
1044867372_1044867379 -4 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867379 8:96585524-96585546 GAAATGAGAAGGATGGGGGCGGG No data
1044867372_1044867381 27 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867381 8:96585555-96585577 GTTTTATGTGTTGTGATGCTTGG No data
1044867372_1044867382 28 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867382 8:96585556-96585578 TTTTATGTGTTGTGATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044867372 Original CRISPR TTTCTCTTCAATCTAAAGCT TGG (reversed) Intronic
900874003 1:5328397-5328419 TTTCTCTTCAATCAGATGCATGG + Intergenic
901250489 1:7774901-7774923 TTTCTCTTGAATGTATACCTAGG + Intronic
902208905 1:14890698-14890720 TTTTTTTTTAATCTAGAGCTGGG + Intronic
902388127 1:16087825-16087847 CTTCTCTTCCATCTAAAGCCTGG - Intergenic
906559836 1:46748414-46748436 CTTCTTTTCCATCCAAAGCTGGG + Intergenic
908835862 1:68229695-68229717 TTGCTCTTAAATCTAAAATTTGG - Intronic
909269012 1:73599762-73599784 TTTCTCTTTCTTCTAAAGCTAGG - Intergenic
909955077 1:81769663-81769685 TTTCTCTTCTATACAAATCTTGG + Intronic
912030528 1:105236951-105236973 TTTCTTCTCAATCTAACGCAGGG - Intergenic
913795958 1:122615181-122615203 TTTCTTTTCATTCTACAGTTTGG + Intergenic
913796148 1:122618581-122618603 TTTCTTTTCATTCTACAGTTTGG + Intergenic
914916314 1:151821373-151821395 TGCCTCGTCAATCTAGAGCTGGG + Intronic
915239140 1:154507404-154507426 TTTCTGTTCAATGTGAAACTTGG + Intronic
917156148 1:172001088-172001110 ATTCTCTTCAATCTATGGCCAGG - Intronic
918765778 1:188481654-188481676 TTTCTCTTCACTTTTCAGCTGGG + Intergenic
919430495 1:197486162-197486184 TACCTCTTCCATCTAAAACTAGG + Intergenic
919682059 1:200445257-200445279 TTTCTCTTGAATGTATACCTAGG + Intergenic
920649975 1:207830368-207830390 TATCTCGTCAATATGAAGCTAGG - Intergenic
922477647 1:225917721-225917743 TTTCTCTTCACTGTATAACTTGG + Intronic
923250906 1:232178970-232178992 TTCCTCTTCACTCTAATTCTTGG - Intergenic
1063540968 10:6933447-6933469 TTTCTCTTCCCTCTTATGCTGGG + Intergenic
1064424611 10:15219471-15219493 TTTCTCTTCAGTCATAATCTAGG + Intronic
1064627022 10:17272186-17272208 TTTCTATGTAATCTAAAGCAGGG + Intergenic
1064780135 10:18827808-18827830 TTTCCCTTCAATCCAAAACATGG + Intergenic
1064791974 10:18967751-18967773 TTTCTCTTGACTATATAGCTAGG - Intergenic
1065044399 10:21733701-21733723 TTTCTCTTCTTTCTTACGCTGGG + Intronic
1065044402 10:21733746-21733768 TTTCTCTTCTTTCTTACGCTAGG + Exonic
1066301808 10:34103938-34103960 TTTTTTTTTAATTTAAAGCTGGG - Intergenic
1066801242 10:39193900-39193922 TTTCTCTTCATTCTGAGGTTTGG - Intergenic
1069484046 10:68809655-68809677 TTTCTCTTGGATATATAGCTAGG + Intergenic
1069639681 10:69946569-69946591 ATGCTCTTCATTCTACAGCTAGG - Intronic
1070587465 10:77777349-77777371 TTTCTCATAAAACTGAAGCTTGG - Intergenic
1070759444 10:79014555-79014577 TTTCCTTTCAATCTGATGCTGGG - Intergenic
1071223553 10:83498505-83498527 TTTCTCCTCAGTGTAAAACTAGG - Intergenic
1071733990 10:88277615-88277637 TTTCTCATCAATCTAAAAGTTGG + Intronic
1073512399 10:104050940-104050962 TGTCTCATCATTCCAAAGCTAGG - Intronic
1074880673 10:117655346-117655368 TTTCTCTCCAGTCTCAAGGTTGG + Intergenic
1075019370 10:118939463-118939485 TTTCTCTTGAATATATACCTAGG - Intergenic
1076444091 10:130500146-130500168 TCTCTCTTCAATCCACAGCATGG - Intergenic
1077958695 11:7049585-7049607 TTTCTTTTCAATCTAATTCTTGG - Intronic
1080074185 11:28129356-28129378 TTTTTCTTAAATATAAAACTTGG + Intronic
1081333935 11:41840553-41840575 TTTCTCTTTATGCTAAAGCGTGG - Intergenic
1081825781 11:46050126-46050148 TATCTCTTCTTTCTAAAACTTGG - Intronic
1082177655 11:49080164-49080186 TTTCTCTTCTATCTCAAATTTGG + Intergenic
1082305379 11:50566421-50566443 TTTCTTTTCATTCTCCAGCTTGG - Intergenic
1082310896 11:50647020-50647042 TTTCTTTTCATTTTAAAGTTTGG + Intergenic
1082586171 11:54943713-54943735 TTTCTTTTCAATCAACAGTTTGG - Intergenic
1082592292 11:55027147-55027169 TTTCTTTTCATTCTACAGTTTGG - Intergenic
1082595344 11:55072748-55072770 TTTCTTTTCATTCAACAGCTTGG + Intergenic
1083001120 11:59291584-59291606 TTTCTCTTCAAACTATTTCTGGG + Intergenic
1083913320 11:65723154-65723176 TTTCTTTTTAATCTATAGCAGGG + Intergenic
1087329061 11:96756345-96756367 TTTCTATTGAATATAAAGTTGGG - Intergenic
1087392187 11:97550662-97550684 TTTTTCTTCCATCTATACCTAGG + Intergenic
1091083912 11:132701529-132701551 TTTGTCTTTAATCTAAAGTGAGG + Intronic
1092862101 12:12727235-12727257 TTTCTCTTCATACTAATTCTTGG - Intronic
1094385647 12:29890356-29890378 TTTCTCTTGAATATAAATGTAGG + Intergenic
1097782042 12:63718643-63718665 TTTCTATTTAATCTAATTCTAGG + Intergenic
1097918287 12:65042979-65043001 TTTCTCTTCAGTATAAATCTAGG + Intergenic
1100620584 12:96268581-96268603 TTAATCTTGAATTTAAAGCTTGG - Exonic
1105943960 13:25174182-25174204 TTTCTATTCACTCCCAAGCTGGG - Intergenic
1106066847 13:26361110-26361132 TTTTTCTTTAATCTTAAGGTTGG + Intronic
1107822069 13:44295228-44295250 TTGGTCTTCAATCTAATTCTTGG - Intergenic
1108333792 13:49418043-49418065 TTTCTCTTGGATATAAACCTAGG - Intronic
1108523777 13:51267959-51267981 TGGCTCTTCCATGTAAAGCTTGG + Intronic
1108729002 13:53213484-53213506 TTTTTCTTCCATCTAAAACCAGG + Intergenic
1108866265 13:54925976-54925998 TTTCTCTTGAATATATACCTAGG - Intergenic
1109010695 13:56938544-56938566 TTGCACTTCAATCTAAACCAGGG - Intergenic
1109922880 13:69092512-69092534 TTTCTCTATAAGCTAAACCTGGG + Intergenic
1110114324 13:71793447-71793469 TTTGTCTTCAATCTATAGCAAGG - Intronic
1112289768 13:98135356-98135378 TTTCTCTTGAATATATACCTAGG + Intergenic
1112421927 13:99260153-99260175 TTTCTCTGCCATCCGAAGCTGGG + Intronic
1112431163 13:99351354-99351376 TTTTTGTACAATCTGAAGCTAGG + Intronic
1112548530 13:100396425-100396447 TTTCTCTTCCCTCTAAAACACGG + Intronic
1113104062 13:106753535-106753557 TTTCTCTTCAGTTAATAGCTTGG - Intergenic
1114738349 14:25066684-25066706 TTTCTATACAATATTAAGCTTGG + Intergenic
1115045491 14:28987781-28987803 TTTCTCTTGCATATAAACCTAGG - Intergenic
1115355270 14:32439901-32439923 TTTGTCTTCAATCTTAAACCAGG - Intronic
1118356427 14:65017657-65017679 TTTTTTTTAAATGTAAAGCTGGG + Intronic
1120440660 14:84534560-84534582 TTTCTCTTTAATTTAGAGCAGGG - Intergenic
1121642669 14:95496148-95496170 TTTCTCTCCTTTCCAAAGCTTGG + Intergenic
1122087225 14:99316422-99316444 TTTCTCTTTTATCTGAAGCCAGG - Intergenic
1122208940 14:100162578-100162600 TTTCTTTTAAATATAAAGTTTGG + Intergenic
1122249181 14:100426085-100426107 TCTCTCTACAAGCCAAAGCTTGG + Intronic
1122925933 14:104900201-104900223 TTTCTCTTGGGTATAAAGCTGGG - Intergenic
1126753498 15:51901302-51901324 TTTCTCTTCAGTATATAGCTAGG + Intronic
1126806200 15:52351808-52351830 TTTATCTGCAAACAAAAGCTAGG - Intronic
1127047961 15:55047578-55047600 TTTCTCTTCAGTACAAACCTAGG + Intergenic
1127694014 15:61426373-61426395 TATCACTTCATTCCAAAGCTGGG + Intergenic
1128653581 15:69439899-69439921 TTTCTCTAAAATCTCAATCTAGG - Exonic
1129588992 15:76898391-76898413 TTTCTCTTGAGTATAAACCTAGG - Intronic
1129873057 15:78953727-78953749 TTTCTCTTGGATATAAACCTAGG + Intergenic
1130948329 15:88566311-88566333 TTTCTCTTATCTCTAAAGCAAGG + Intergenic
1131944192 15:97601081-97601103 TTTCTCTTTAGTCTATAGCTGGG - Intergenic
1132272323 15:100537340-100537362 GCTCACTTCAATCTCAAGCTTGG - Intronic
1134118211 16:11565421-11565443 TTTCTCTTCACTAAAAAGCGGGG + Intronic
1134603759 16:15553770-15553792 TTGCTCCTCAATCTTTAGCTGGG - Intronic
1135955497 16:26953256-26953278 TTTCTCTTGGCTCTGAAGCTTGG + Intergenic
1136741346 16:32531747-32531769 TTTCTTTTCATTCAACAGCTTGG - Intergenic
1136921690 16:34285886-34285908 TTTCTTTTCATTCTGAAGTTTGG + Intergenic
1137855233 16:51788045-51788067 TTTGTCTTCAGTTTAGAGCTTGG - Intergenic
1140794124 16:78420260-78420282 TTTCTCTTCAAGATACATCTAGG - Intronic
1141390711 16:83660912-83660934 TTTTTCTTCAATTTCAGGCTTGG - Intronic
1203028257 16_KI270728v1_random:543487-543509 TTTCTTTTCATTCAACAGCTTGG + Intergenic
1203043464 16_KI270728v1_random:790944-790966 TTTCTTTTCATTCAACAGCTTGG - Intergenic
1144213564 17:13035121-13035143 TCTCTCTTTCATCTAATGCTGGG - Intergenic
1144214078 17:13039307-13039329 TTTCCCTTCATTCTATAGGTGGG - Intergenic
1149817023 17:59735618-59735640 TTTTTCTTCAACCTAAAGAAAGG - Intronic
1150317041 17:64177823-64177845 TCTTTCTTCAAGCTAAGGCTTGG + Intronic
1153897260 18:9576930-9576952 TTTCTCTTGAATATAAAAATTGG - Intronic
1157098147 18:44705950-44705972 TTTCTCTTTCATATAAAACTAGG + Intronic
1157665317 18:49481310-49481332 TTTGTATTCACTCTGAAGCTGGG - Exonic
1158436833 18:57440073-57440095 TTTCTCTGAAATCTAACGTTGGG - Intronic
1158902284 18:61975142-61975164 CTTCCCTTAATTCTAAAGCTTGG - Intergenic
1159632243 18:70762705-70762727 TTTTTCTTCAAGCTAAAGATTGG + Intergenic
1160363818 18:78307596-78307618 TTTCTCTCCCATCTTAAGGTTGG - Intergenic
1161744922 19:6050646-6050668 TTTCTCTTCATTCTTCAGATTGG - Intronic
1163511583 19:17738749-17738771 TGTCTCTTCAAGCTGGAGCTTGG - Intergenic
1168492218 19:56820653-56820675 TTTCCCTTCAATCCAAATCAAGG + Intronic
925031880 2:656345-656367 TTTCTCTTCAATACACAGCTGGG + Intergenic
925434530 2:3825507-3825529 TTTCTTTCCAAGTTAAAGCTGGG + Intronic
927029124 2:19102336-19102358 TTTCTCATCTATCAAAAACTTGG - Intergenic
927061936 2:19431526-19431548 TATATCTCCAATCTACAGCTTGG + Intergenic
928629539 2:33176627-33176649 TTTCTCTAGAATCTAGTGCTGGG - Intronic
929112312 2:38415210-38415232 TCTCGCTGCAGTCTAAAGCTTGG + Intergenic
929175845 2:38975059-38975081 TTTCTGTTCATTCAAAATCTTGG + Exonic
930334151 2:50024423-50024445 TTTCTCATAAATATAAAGGTAGG - Intronic
931688331 2:64813945-64813967 TTTCTCCTCAATTTAAAGGGTGG - Intergenic
932796098 2:74697694-74697716 TCTTTCTTCTATCTAAAGCCTGG - Intergenic
933467174 2:82667446-82667468 TTTTTCTTCAAAGTAAAGATGGG - Intergenic
933801353 2:85962492-85962514 ATTCTCAGCAATCTAAAGGTAGG - Intergenic
936456396 2:112677984-112678006 TTTCTCTAAAATCTAAATCTAGG + Intergenic
936733947 2:115417588-115417610 TTTTTCTTATATCTAAAGCGGGG - Intronic
936886717 2:117319232-117319254 ATTCTCTGCCATATAAAGCTCGG - Intergenic
938747515 2:134293739-134293761 CTTTTCTTCAATTTAAAGCAAGG - Intronic
939101174 2:137896720-137896742 TTTTCCTTCAATCTTAAGATAGG - Intergenic
939165184 2:138633753-138633775 TTTCTCTTGAATAAAAATCTGGG - Intergenic
939248008 2:139649835-139649857 TTTCTCTTCCATTTCAACCTTGG - Intergenic
940227435 2:151414443-151414465 TGTCACTCCACTCTAAAGCTAGG + Intronic
940697672 2:157000044-157000066 TTTCTCTTCAGTCTAATTCTAGG - Intergenic
942871502 2:180739979-180740001 TTTCTATACAATCTATAGCATGG - Intergenic
942933340 2:181523592-181523614 TTTCTATGCAACCTAAAGATAGG - Intronic
943402369 2:187430340-187430362 TTTCTCCTAAATTTAAAGCTGGG - Intronic
943619722 2:190135490-190135512 TTTCTCTTCAGTCAAATGATGGG + Intronic
944905259 2:204255933-204255955 TTCCTTTTCAATCTATGGCTGGG + Intergenic
945072540 2:206005658-206005680 TTTCCCTCCAATCAAAATCTTGG - Intronic
946906219 2:224418983-224419005 TTTCTCTCCAACTTGAAGCTTGG + Intergenic
947179394 2:227398848-227398870 TTTCTCTGTATTCTAAAGCAGGG + Intergenic
947538223 2:230954382-230954404 TTTCTGTTGGATTTAAAGCTTGG + Intronic
1170964161 20:21051717-21051739 TTTCTCTTGAATCTATGCCTGGG + Intergenic
1171371075 20:24662304-24662326 TTACTCTTCAATTTAAAAATCGG + Intronic
1173057336 20:39628203-39628225 CTTCTTTTCATTCTAAGGCTTGG - Intergenic
1173457756 20:43216973-43216995 TTTCTCCTCCATGTAAAGTTTGG + Intergenic
1173933170 20:46838630-46838652 TTTCTCATGATTCTAAAGGTTGG - Intergenic
1179228996 21:39483620-39483642 TCTCTCTTCATTTTATAGCTGGG - Intronic
1180217992 21:46338458-46338480 CTACTGATCAATCTAAAGCTTGG - Intronic
1181754630 22:25014886-25014908 GATCTCCTCAATCTAAAGCAGGG + Intronic
1182198975 22:28549835-28549857 TTTTTCTTCAATCTAAAGATTGG + Intronic
1182945575 22:34318304-34318326 TTTCTCTTAGATATAAACCTTGG - Intergenic
1183196931 22:36360008-36360030 TTTGTCCTCATTCTAAAGCTAGG - Intronic
949771669 3:7586110-7586132 TTTCTCTTAAACCTAGAGGTAGG - Intronic
951596051 3:24319250-24319272 TTTCTCTTGGATATAAACCTAGG - Intronic
953586831 3:44208954-44208976 TTTCTCTTGAATATATACCTAGG - Intergenic
955974515 3:64467492-64467514 TTTCTCTCCAGTCTGATGCTGGG - Intergenic
956234278 3:67050719-67050741 TTTCTCTACAAGCTAAAACCTGG - Intergenic
957747964 3:84369285-84369307 TTTCTCTTAAATATATAGTTTGG - Intergenic
958556909 3:95690922-95690944 TTTTTTTTTAATATAAAGCTGGG + Intergenic
959089088 3:101883137-101883159 TTGCTCATAAATCTATAGCTTGG - Intergenic
959580680 3:107979504-107979526 TTTCTCTTACTTCTAAATCTTGG + Intergenic
960011340 3:112836672-112836694 TTTCTCTTTAATCTAAAATTAGG + Intronic
960173773 3:114493531-114493553 TATCTCTTCAACCTCAACCTGGG + Intronic
960345313 3:116522967-116522989 TTTCTCTGCAATTAAAACCTGGG + Intronic
963205358 3:142628987-142629009 TCACTATTCAATCTAAGGCTGGG - Intronic
963920959 3:150905085-150905107 TTTCTCTTTCATTTAAAGGTTGG - Exonic
965247349 3:166290719-166290741 TTTGTCTTCAGTCTCAAACTTGG + Intergenic
965392678 3:168124057-168124079 TTTCTCCACAATTTAAATCTTGG - Intergenic
965448036 3:168800333-168800355 TTTCTCTTCAGTAAAAACCTAGG + Intergenic
967675747 3:192296803-192296825 TTTTTCTGAAATCTAAAGTTTGG - Intronic
969980763 4:11151796-11151818 TCTCTCTTCCATCTAATGGTAGG - Intergenic
971445173 4:26737010-26737032 TTTCTGTTCATTCTAAAGGTAGG - Intronic
971590637 4:28464347-28464369 TTTCTCTTGAATCTAGGTCTTGG - Intergenic
972126401 4:35772084-35772106 TTTCTTGTCAATCCAAAGCTCGG + Intergenic
974292670 4:59953247-59953269 TTTCTCTAAAATCTAGAGCACGG + Intergenic
974498189 4:62660916-62660938 TTTCTATTCACTCTAGAGTTAGG + Intergenic
974789863 4:66673048-66673070 TTTCTCAACAATCTAAAGTCGGG + Intergenic
979072005 4:116219854-116219876 TTTCTCATAAATCTGAAGGTTGG - Intergenic
979340555 4:119517695-119517717 TTTTTTTTCACTCTAAAGCAGGG + Intronic
979771558 4:124531394-124531416 TTACTATTAAATCTAGAGCTGGG - Intergenic
981215803 4:142165722-142165744 TTTCTCTTGAATCAATAACTAGG + Intronic
981703646 4:147635697-147635719 TTTCTATTAAAACTAAAACTGGG + Exonic
981730419 4:147891121-147891143 TTTCTCTTGAATGTATAGCTAGG - Intronic
981849083 4:149206874-149206896 TTTCTCTTGAATATATACCTTGG - Intergenic
982586674 4:157250146-157250168 TGTATCTTCAACTTAAAGCTGGG - Intronic
983800406 4:171921936-171921958 TTTTTCTTCAAAGAAAAGCTGGG + Intronic
986075717 5:4336225-4336247 TTTCTATTTAATCTAAAAATAGG + Intergenic
986783899 5:11092758-11092780 TTACATTTAAATCTAAAGCTTGG + Intronic
987435568 5:17889127-17889149 TTTCTCTTCTTTCTTAAGCATGG + Intergenic
987807954 5:22794608-22794630 TTTCTATTCTCTCTAAATCTTGG - Intronic
989478215 5:41898878-41898900 TATCTCTTCAGTATATAGCTAGG + Intergenic
989625645 5:43427035-43427057 TTGTTCTTCACTCTAAAGCAGGG - Intergenic
989832839 5:45941956-45941978 TTTCTTTTCATTCAAAAGTTTGG + Intergenic
989845903 5:46140685-46140707 TTTCTTTTCATTCAAAAGTTTGG + Intergenic
989848327 5:46174596-46174618 TTTCTTTTCATTCAAAAGTTTGG - Intergenic
990621630 5:57565980-57566002 TTTCTCTTCAATCTATCCTTTGG - Intergenic
990828299 5:59927279-59927301 TTTCTCTCAAATGCAAAGCTTGG + Intronic
991195855 5:63931371-63931393 TTTATGTTAAATGTAAAGCTTGG + Intergenic
992463166 5:76981808-76981830 TTTCTCCTCACTATAAAGATAGG + Intergenic
993566291 5:89479866-89479888 TTTCTCTTAAGTCTATGGCTTGG - Intergenic
995462069 5:112414026-112414048 TTTCTCTTCATTTTACAGATGGG + Intronic
996585801 5:125086849-125086871 TTTCTGTTCAATAGAAAACTTGG - Intergenic
997037431 5:130209537-130209559 TTTATATTGAATCGAAAGCTGGG - Intergenic
997392178 5:133526226-133526248 ATTCTCTTCACTATACAGCTGGG + Intronic
997404868 5:133637644-133637666 TGTCTCTTCCATCTAAAAGTTGG + Intergenic
997422219 5:133778763-133778785 ACTCTCTTCATTCTAAAGCAAGG + Intergenic
999085558 5:148885741-148885763 TTTCTCTGAGATCTGAAGCTAGG + Intergenic
1000591498 5:163164259-163164281 TTTCTCTTGAGTCTATAGTTTGG - Intergenic
1005047427 6:21655315-21655337 TATTACTTCATTCTAAAGCTAGG + Intergenic
1007140648 6:39570015-39570037 TTGCATTTCAATATAAAGCTTGG + Intronic
1008488991 6:52065714-52065736 TTTCTCTTCACTCACAAGATAGG + Intronic
1008772649 6:54997833-54997855 TTTCTTCTCAAACTAAAGTTTGG + Intergenic
1009261937 6:61502392-61502414 TTTCTTTTCAATCAACAGTTTGG - Intergenic
1010145905 6:72669359-72669381 TTTCCATTCAATCTTAAGGTTGG + Intronic
1012524285 6:100158506-100158528 TTTCCATTCAATGTAAATCTGGG - Intergenic
1013444918 6:110215343-110215365 TTTCTCTCCAACATAAATCTGGG + Intronic
1014976503 6:127891621-127891643 TTTCTCTTCACACTAAATCAAGG + Intronic
1015496768 6:133890891-133890913 TTTCTCTCCAATTGAAAGTTTGG + Intronic
1015636648 6:135281783-135281805 TTTCTCGTCAATCTAAAAAAGGG - Intergenic
1015809919 6:137152027-137152049 TTTCTCTTCAATATATACATAGG - Intronic
1016695762 6:146993263-146993285 TTGCTCTTGTATCTAAAGATAGG - Intergenic
1020420022 7:7992388-7992410 ATGCTCTTCAATCAAAAGCCTGG - Intronic
1022940642 7:35234741-35234763 TTTCTATTTAATCTAATTCTAGG + Intronic
1025524560 7:61788348-61788370 TTTCTTTTCATTCAAAAGTTTGG - Intergenic
1025531181 7:61886326-61886348 TTTCTTTTCATTCAACAGCTTGG - Intergenic
1025534053 7:61926189-61926211 TTTCTTTTGATTCAAAAGCTTGG + Intergenic
1025547921 7:62200566-62200588 TTTCTTTTCATTCAAAAGTTTGG - Intergenic
1025581090 7:62718876-62718898 TTTCTTTTCATTCTGAAGTTTGG + Intergenic
1025581152 7:62719906-62719928 TTTCTTTTCATTCTGAAGTTTGG + Intergenic
1025585210 7:62776165-62776187 TTTCTTTTCATTCAAAAGTTTGG + Intergenic
1025587306 7:62807080-62807102 TTTCTTTTCATTCCAAAGTTTGG - Intergenic
1025589061 7:62832306-62832328 TTTCTTTTCAGTCTCAAGTTTGG + Intergenic
1025597114 7:62943955-62943977 TTTCTCTTCAATCAGCAGTTTGG + Intergenic
1025598862 7:62969208-62969230 TTTCTTTTCAATCAACAGTTTGG + Intergenic
1026056308 7:66986868-66986890 TTTCTGTTAATGCTAAAGCTAGG - Intergenic
1026107957 7:67435912-67435934 TTTCTCTTCACTCCAAACTTTGG + Intergenic
1026721780 7:72838191-72838213 TTTCTGTTAATGCTAAAGCTAGG + Intergenic
1027594002 7:80150176-80150198 TTTCTCTGGAATCTATACCTAGG - Intronic
1027716022 7:81670986-81671008 TTTCTCTTCCATCAAAAGCAGGG + Intergenic
1027768452 7:82375956-82375978 TTTCTGTGTCATCTAAAGCTGGG + Intronic
1028105269 7:86869137-86869159 TCTCTCTTCACTGTGAAGCTGGG - Intergenic
1030024687 7:105311857-105311879 TTTCTTTTGAATATAAACCTAGG - Intronic
1030041059 7:105450361-105450383 TTTCTCTTGAGTATAAAGCTAGG - Intronic
1030215802 7:107042899-107042921 TTTCTCTGGAATCTAAATGTGGG - Intergenic
1030375263 7:108746217-108746239 TTTCTCTTGAATCTCCACCTGGG - Intergenic
1030879886 7:114865085-114865107 TCAGTCTTCAATCTAAAGCTGGG + Intergenic
1033413797 7:141144949-141144971 TTTCCCCTCAACCTAGAGCTAGG - Intronic
1033645769 7:143302538-143302560 TTTCTCTTCACTCTATCCCTAGG + Intronic
1034007912 7:147494644-147494666 TTTCTCTTCACTCTGAACCTTGG - Intronic
1034326200 7:150236206-150236228 TTTCTCATCAATCTAGAGGCAGG + Intergenic
1034767004 7:153733050-153733072 TTTCTCATCAATCTAGAGGCAGG - Intergenic
1036922395 8:12870318-12870340 TTTCTCTTCCCTACAAAGCTAGG - Intergenic
1037256252 8:16958286-16958308 TTTCTCATCAATCTATGGGTTGG - Intergenic
1039276615 8:35939521-35939543 TTTTTCTTCAAACTAGAGATTGG - Intergenic
1040456986 8:47608440-47608462 TTTCTCTTGAATATATACCTAGG + Intronic
1042003466 8:64153839-64153861 TTTCTCTTCTGTCAAAAGATAGG - Intergenic
1044377216 8:91489709-91489731 TTTCTCTTGATTCTAACTCTAGG - Intergenic
1044867372 8:96585505-96585527 TTTCTCTTCAATCTAAAGCTTGG - Intronic
1045277012 8:100716538-100716560 TTACTTTTTATTCTAAAGCTGGG - Intronic
1046212903 8:111101545-111101567 TTTCTCTTGAATATATACCTAGG - Intergenic
1047018927 8:120753972-120753994 TGTCTCATCAATCTAAATTTGGG + Intronic
1047551633 8:125879349-125879371 TTTCTCTTCACTCTATTGATTGG + Intergenic
1047894699 8:129353622-129353644 TTTCTCTCCAATAAAAAGCAGGG - Intergenic
1048475308 8:134737449-134737471 TTGCTCTTCAAACTTAAGCCAGG + Intergenic
1048640621 8:136355251-136355273 TTTCTCTTCATTTTACAGATTGG + Intergenic
1048911030 8:139135300-139135322 TTTATCTTAACTCTAGAGCTTGG - Intergenic
1052175382 9:25456120-25456142 TTACTTTCCAAACTAAAGCTAGG + Intergenic
1054821714 9:69528315-69528337 TTTCTCTTTAATCAAAGGCTGGG - Intronic
1054863515 9:69976683-69976705 TTTCTGTTCCTTCTAAATCTGGG - Intergenic
1056312130 9:85351529-85351551 TTCCTCTTCAAACTAGACCTTGG - Intergenic
1057026663 9:91739209-91739231 ATTCTGTTCAATTTAAGGCTAGG + Intronic
1057040810 9:91846155-91846177 TGTCTCTTCATCTTAAAGCTTGG + Intronic
1058172583 9:101700725-101700747 TTTATCTGCTATCTAAAGCGAGG + Intronic
1058190165 9:101904809-101904831 TTTGTCTTCTATCTAGAGCCAGG + Intergenic
1058283084 9:103142712-103142734 TTGCTCTTCAACCCAAGGCTGGG - Intergenic
1058806051 9:108593221-108593243 TTTCTCTTCACATAAAAGCTTGG - Intergenic
1060604665 9:124903073-124903095 TTTCTCTTCAGTGTATACCTAGG - Intronic
1060837225 9:126765539-126765561 TTTCTCTTCACCCAAAAGATTGG + Intergenic
1186264662 X:7818986-7819008 TTTCTCTTCAATGCATGGCTAGG - Intergenic
1186583651 X:10848383-10848405 TCTCTCTTCAAACAGAAGCTAGG + Intergenic
1186643101 X:11478184-11478206 TTTCTCTTGGGTATAAAGCTAGG - Intronic
1186994229 X:15102549-15102571 TTTCTCTTACATGTAAACCTAGG + Intergenic
1187513907 X:19948193-19948215 TTTCTCTTCAGTATATAGCTAGG - Intronic
1188131349 X:26437156-26437178 TTTCTCTTCAAGTTAAGGGTCGG + Intergenic
1190366540 X:49699972-49699994 TTTCTCTTGAGTATACAGCTAGG + Intergenic
1192891499 X:75396634-75396656 TTTCTCTTCAGTATATAACTAGG - Intronic
1193348047 X:80427196-80427218 TTTAACTTCAATGTAAAACTTGG + Intronic
1194314211 X:92354503-92354525 TTTCTCATCAATCAAAAGAGAGG - Intronic
1194877924 X:99212353-99212375 TTTCTCTTCAGTCTAAAACAAGG + Intergenic
1195666902 X:107440060-107440082 TTTCTCTTTAATCGGAAGATGGG - Intergenic
1196195184 X:112831971-112831993 TTTCTCTCCACACTACAGCTGGG - Intronic
1196885296 X:120239015-120239037 TTTCTCTTGACTCTATTGCTTGG - Intergenic
1197022391 X:121706830-121706852 TTTCACTTTAATCAATAGCTTGG + Intergenic
1197103506 X:122685584-122685606 TTTCTCTTCAATAAATACCTAGG + Intergenic
1198814191 X:140569754-140569776 TTTCTCTTGAGTGTATAGCTAGG - Intergenic
1199074396 X:143512265-143512287 CTTCTGTTAATTCTAAAGCTTGG + Intronic
1199093397 X:143715532-143715554 CTTCTGTTAATTCTAAAGCTTGG + Intronic
1200371942 X:155736890-155736912 TTTCTCTTCGATTTTCAGCTTGG + Intergenic