ID: 1044867377

View in Genome Browser
Species Human (GRCh38)
Location 8:96585520-96585542
Sequence AAGAGAAATGAGAAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044867371_1044867377 11 Left 1044867371 8:96585486-96585508 CCAGGGCTGCTCATTGTTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data
1044867370_1044867377 12 Left 1044867370 8:96585485-96585507 CCCAGGGCTGCTCATTGTTGCCA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data
1044867372_1044867377 -8 Left 1044867372 8:96585505-96585527 CCAAGCTTTAGATTGAAGAGAAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044867377 Original CRISPR AAGAGAAATGAGAAGGATGG GGG Intronic
No off target data available for this crispr