ID: 1044868785

View in Genome Browser
Species Human (GRCh38)
Location 8:96598261-96598283
Sequence AGGTTTTAACACATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044868779_1044868785 16 Left 1044868779 8:96598222-96598244 CCTGAAGTCCCTCTTCTTAATAC 0: 1
1: 0
2: 3
3: 57
4: 330
Right 1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG No data
1044868780_1044868785 8 Left 1044868780 8:96598230-96598252 CCCTCTTCTTAATACTATTGCAT 0: 1
1: 10
2: 71
3: 245
4: 793
Right 1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG No data
1044868781_1044868785 7 Left 1044868781 8:96598231-96598253 CCTCTTCTTAATACTATTGCATT 0: 12
1: 55
2: 191
3: 567
4: 1553
Right 1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG No data
1044868778_1044868785 27 Left 1044868778 8:96598211-96598233 CCTGCTCATCTCCTGAAGTCCCT 0: 1
1: 0
2: 3
3: 28
4: 253
Right 1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044868785 Original CRISPR AGGTTTTAACACATGGATTT TGG Intronic
No off target data available for this crispr