ID: 1044869876

View in Genome Browser
Species Human (GRCh38)
Location 8:96608140-96608162
Sequence GTGCAAACCATGAACTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044869874_1044869876 -2 Left 1044869874 8:96608119-96608141 CCTGATCATGCGATGGGTGTTGT 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1044869876 8:96608140-96608162 GTGCAAACCATGAACTACATGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1044869871_1044869876 6 Left 1044869871 8:96608111-96608133 CCGACTTGCCTGATCATGCGATG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044869876 8:96608140-96608162 GTGCAAACCATGAACTACATGGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044869876 Original CRISPR GTGCAAACCATGAACTACAT GGG Intronic
901948122 1:12719802-12719824 CTGCAAACCATGAACTGCCCTGG - Intronic
909714051 1:78685992-78686014 GTCCAAAGCATGACCTACATAGG - Intergenic
910087481 1:83420457-83420479 GCTCAAACCATCATCTACATGGG + Intergenic
921692092 1:218164181-218164203 GTGCAAACAATGAAATAAACGGG - Intergenic
921922419 1:220684538-220684560 TTATAAACCATGAACTAGATAGG - Intergenic
1065240930 10:23703336-23703358 GTGCAGATCAGGAAGTACATAGG - Intronic
1065684922 10:28274682-28274704 GCTCAAACCCTGGACTACATAGG + Intronic
1066055273 10:31674763-31674785 CTGCAAACCAGGAACCAAATTGG - Intergenic
1073651513 10:105364813-105364835 TCGCAAACCAAGAAATACATAGG - Intergenic
1074278653 10:112029294-112029316 GTGCAAATCATAAACTGGATTGG - Intergenic
1076579835 10:131499892-131499914 GTGTAAAACATGTACTCCATGGG - Intergenic
1079780561 11:24597632-24597654 GATCTAACCATGAACTACAAGGG - Intronic
1092234922 12:6800764-6800786 GTGCAAAGTATTATCTACATAGG - Intronic
1092726656 12:11492980-11493002 GAGCAAACTACAAACTACATTGG + Intronic
1094342576 12:29429458-29429480 ATGTAAAACATGACCTACATTGG - Intronic
1103571788 12:121849744-121849766 GTGGAGAAGATGAACTACATCGG - Exonic
1107876628 13:44796479-44796501 TTGCAAACCCTGAACAATATAGG - Intergenic
1111709011 13:91787638-91787660 GTGTAAACCATTTAATACATAGG - Intronic
1113496196 13:110731175-110731197 GTGCCAACCATCAGATACATGGG + Intergenic
1115344410 14:32327092-32327114 GTGGAAACCATCAACTCCAAAGG - Intergenic
1120328832 14:83061441-83061463 ATGCAACCCATGATCTTCATGGG - Intergenic
1124693005 15:31841313-31841335 GGTCAAACCATGAACTGCCTCGG + Intronic
1127478761 15:59358972-59358994 GGGGAGACCATGAACCACATTGG + Intronic
1130804681 15:87307260-87307282 GTGCAAACAAAGAAGTAGATAGG - Intergenic
1139658896 16:68406660-68406682 GTGAAAACTCTGAACCACATCGG - Intronic
1144146335 17:12402825-12402847 GTGGAAAATATGAAGTACATTGG + Intergenic
1144225095 17:13137632-13137654 ATGTAAACCATGAACTCCTTAGG - Intergenic
1144849034 17:18234798-18234820 GTGCGAGCCATGAACCACTTGGG - Intronic
1145838822 17:27976467-27976489 GTGCAACTCATGACCTAGATTGG - Intergenic
1148407482 17:47430108-47430130 GTGCCAACCCTGAGCTTCATGGG + Intronic
1150545184 17:66149706-66149728 GAGCAAACTTTTAACTACATGGG - Intronic
1157826443 18:50816623-50816645 TTCCAAACCATGATCTAAATGGG + Intronic
1164029717 19:21392737-21392759 TTGCAATCCATGAGCTGCATTGG - Intergenic
1164194035 19:22937958-22937980 TTGCAATCCATGGGCTACATTGG + Intergenic
926323556 2:11765533-11765555 GTGCAGACCATGAATTACGTGGG + Exonic
927924949 2:27005531-27005553 CTGCAAAGCATGAACTGCAAAGG + Intronic
931645871 2:64421460-64421482 GTCAAAACCATGAGCTCCATTGG - Intergenic
932118683 2:69078055-69078077 GTGCAAACCCTGGACAACACTGG - Intronic
940636930 2:156308927-156308949 GTACAAACCAAGAAGTACAACGG + Intergenic
942663918 2:178296260-178296282 GTGCTAATCATCTACTACATAGG - Intronic
942926338 2:181437556-181437578 GTGAAAAAGATGAACTACTTGGG + Intergenic
945852080 2:215020884-215020906 GTGGAAACAATGGAGTACATTGG + Intronic
946722458 2:222624493-222624515 GAACAAACCATAAACTTCATTGG + Intronic
1169767344 20:9161313-9161335 GTAAAAACCATGAACCACTTAGG - Intronic
1170237920 20:14128304-14128326 GTTCAAACTATGAACAACAGTGG + Intronic
1177310040 21:19378469-19378491 ATGCAAACCATGAAATAAACTGG - Intergenic
1178743479 21:35225216-35225238 GTGCAAACAATTAAATATATTGG + Intronic
1178798869 21:35773102-35773124 GCACAAACCATGAGCTAAATAGG + Intronic
1178799753 21:35781645-35781667 GTCCAAGACATGAAATACATAGG - Intronic
1178971519 21:37182213-37182235 TTTCAAACCAGCAACTACATAGG + Intronic
1182966215 22:34523588-34523610 GAGCAAACCATGAGCTAGCTGGG - Intergenic
1183308961 22:37098953-37098975 GTGCTAACCACCTACTACATGGG + Intronic
1183580559 22:38723595-38723617 GTTCAGACCAAGAACTAAATAGG - Intronic
956868823 3:73396354-73396376 CTGCAAACCAGGACCTACCTCGG - Intronic
959616273 3:108351202-108351224 GTGCAAGCCATTAAATTCATGGG - Intronic
962632842 3:137297295-137297317 GTACAAAGAATGAACTACATGGG + Intergenic
969643770 4:8414072-8414094 GTGCCCACCATGAACTTTATGGG - Intronic
973837206 4:54822041-54822063 TTACAATCGATGAACTACATTGG + Intergenic
976213191 4:82692334-82692356 GCGCAGACCAAGAACTGCATGGG - Intronic
982043830 4:151421848-151421870 TTGCAAACCATGAACTGCCAAGG - Intronic
985204073 4:187514723-187514745 TTGAAATACATGAACTACATGGG - Intergenic
988387077 5:30578214-30578236 GTCTACACTATGAACTACATAGG - Intergenic
994211882 5:97096175-97096197 GTGAAAACCATTAAATACACAGG + Intronic
995065772 5:107860851-107860873 CTGCACACCATTAATTACATTGG + Exonic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999489173 5:152032303-152032325 GAGCAAACCATGAAATAAGTGGG + Intergenic
1002798241 6:494405-494427 GTGCATATCATTAACTACAGTGG + Intronic
1010273669 6:73944039-73944061 GAGCAAACCATGAACAATGTAGG - Intergenic
1011550890 6:88530277-88530299 GTGCACTCCATGAACTTCTTTGG - Intergenic
1018140754 6:160832184-160832206 TAGAAAACCATGTACTACATTGG + Intergenic
1027304361 7:76876938-76876960 GCTCAAACCATCATCTACATGGG + Intergenic
1027540866 7:79463505-79463527 ATGCAAACAATAAACTAGATTGG - Intergenic
1028961520 7:96754408-96754430 GTGCAAGTCATGAACTCCAATGG - Intergenic
1030692525 7:112550777-112550799 GTGGTAGCCGTGAACTACATTGG - Intergenic
1030957555 7:115873619-115873641 CTGCAAACCAGGAACTTCTTTGG - Intergenic
1031340715 7:120596789-120596811 ATGTAGACCATGAACTTCATTGG - Intronic
1032496515 7:132367174-132367196 TTGCAAATCATTAACTACATTGG + Intronic
1037561145 8:20075426-20075448 GTGCAAACCATGTTCTATCTAGG + Intergenic
1041649311 8:60286108-60286130 GTGCCTACCATGTGCTACATGGG - Intergenic
1042383770 8:68150166-68150188 GTGCAAAGCATGGACTACAGAGG - Intronic
1043330977 8:79118471-79118493 ATAAAAATCATGAACTACATTGG + Intergenic
1044869876 8:96608140-96608162 GTGCAAACCATGAACTACATGGG + Intronic
1045901701 8:107289437-107289459 ATGCAACCCATGGAATACATGGG - Intronic
1047142818 8:122161105-122161127 GTACAAACTATGACTTACATAGG - Intergenic
1051272570 9:15369584-15369606 GTCCCAACCAAGAACTACAAAGG - Intergenic
1053457781 9:38244255-38244277 GTGCAAACTTTGAAGTACAAGGG - Intergenic
1055975539 9:81951166-81951188 GTGCAACCTATGATCTTCATGGG + Intergenic
1057828168 9:98387022-98387044 TTGTAAACCGTGAACTACTTAGG + Intronic
1058454010 9:105122443-105122465 TTCCAAAACATGAACTACTTAGG + Intergenic
1059783551 9:117555391-117555413 GTGAATACCATGAAGTGCATAGG - Intergenic
1199292097 X:146116074-146116096 ATGCAAACAATGAAATACTTAGG - Intergenic
1200706125 Y:6444042-6444064 CTGCAAAGCATAAACAACATCGG + Intergenic
1201027985 Y:9720666-9720688 CTGCAAAGCATAAACAACATCGG - Intergenic