ID: 1044870850

View in Genome Browser
Species Human (GRCh38)
Location 8:96618509-96618531
Sequence ACCAGGGCCTTGGGGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044870842_1044870850 -1 Left 1044870842 8:96618487-96618509 CCATGGTGTGTGGGGAAGGGGAA No data
Right 1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044870850 Original CRISPR ACCAGGGCCTTGGGGGATCT GGG Intergenic
No off target data available for this crispr