ID: 1044875959

View in Genome Browser
Species Human (GRCh38)
Location 8:96666578-96666600
Sequence CAGAACATGGGAAAGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044875954_1044875959 -5 Left 1044875954 8:96666560-96666582 CCCTAAAGAAAATAAAGCCAGAA 0: 1
1: 0
2: 6
3: 87
4: 898
Right 1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG No data
1044875955_1044875959 -6 Left 1044875955 8:96666561-96666583 CCTAAAGAAAATAAAGCCAGAAC 0: 1
1: 0
2: 6
3: 76
4: 905
Right 1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG No data
1044875949_1044875959 28 Left 1044875949 8:96666527-96666549 CCTAGACCAGAGTGTAGGGATCA 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG No data
1044875952_1044875959 22 Left 1044875952 8:96666533-96666555 CCAGAGTGTAGGGATCAGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 249
Right 1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044875959 Original CRISPR CAGAACATGGGAAAGTATGC TGG Intronic
No off target data available for this crispr