ID: 1044878997

View in Genome Browser
Species Human (GRCh38)
Location 8:96702766-96702788
Sequence TTACAGAAGGAGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 788}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044878997_1044879003 -4 Left 1044878997 8:96702766-96702788 CCCTCCCCTTTCTCCTTCTGTAA 0: 1
1: 0
2: 4
3: 89
4: 788
Right 1044879003 8:96702785-96702807 GTAAACAAGTGTCTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044878997 Original CRISPR TTACAGAAGGAGAAAGGGGA GGG (reversed) Intronic
900694129 1:3999721-3999743 TCACAGAGGGAGGAAGGGGCCGG + Intergenic
901425504 1:9180345-9180367 CTACAGAAGGATGAGGGGGACGG - Intergenic
901688850 1:10959710-10959732 TTCCAGAAGCAGAAAGGAGTGGG + Intronic
901916812 1:12506396-12506418 TTAGAGAGGGAGGAAGCGGATGG + Intronic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902539531 1:17144050-17144072 TTTCAAAAGAAGAGAGGGGATGG + Intergenic
902640083 1:17761521-17761543 TTACCGAAGGAACACGGGGAAGG + Intronic
902648132 1:17818327-17818349 TTACAGGAGGTGAAAGGTGTGGG - Intronic
902840389 1:19070506-19070528 TGACAGGAGGAGGAAGGGGCAGG + Intergenic
903014524 1:20353442-20353464 TTACACAGGGAGAAAGAGGAAGG + Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903238983 1:21969920-21969942 TTCCAGATGAAGAAAAGGGAAGG - Intergenic
904041107 1:27585778-27585800 TAACAGTTGGAGGAAGGGGAGGG - Intronic
904092527 1:27955444-27955466 TTACAGAAGTGAAAAGGAGAAGG + Intronic
904344973 1:29861777-29861799 GGACACAAGGAGAAAGGGGTGGG + Intergenic
904464774 1:30701316-30701338 CTTCAGGAGGAGGAAGGGGAGGG - Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
904948954 1:34220524-34220546 ATACAAAAGCAGAAATGGGATGG + Intergenic
905632062 1:39524501-39524523 TTCCAGAAGGAGCAAGTGCAAGG + Intronic
905649596 1:39647415-39647437 TTCCAGACAGAGAAAGGGAAAGG - Intergenic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
905853821 1:41294022-41294044 TTGGAGATGGAGAAAAGGGAAGG + Intergenic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906429935 1:45748369-45748391 TTAAAGAGGGTGAAAGGGGCTGG + Intronic
906540605 1:46583040-46583062 TTACAGAAAGAGAGCAGGGATGG - Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
906994625 1:50778668-50778690 GAAGAGAAGGAGGAAGGGGAGGG + Intronic
907484129 1:54765323-54765345 TTAGAGAAGGAGAATGGAGTGGG + Intergenic
907555449 1:55339766-55339788 TTACAGGAGGAAATTGGGGATGG - Intergenic
907709321 1:56863934-56863956 TTACAAAAGGAAAAAAGGAAGGG - Intronic
908047015 1:60181869-60181891 TCCCAGAAAAAGAAAGGGGATGG - Intergenic
908488614 1:64620093-64620115 TTAGAGAAGGAGAAGTGGGCTGG + Intronic
908786276 1:67737532-67737554 TTACTGATGCAGAAAGGGAAAGG - Intronic
910039118 1:82826435-82826457 TTACAGGAGGAGGAAGGTGGAGG + Intergenic
910057833 1:83052708-83052730 TTTCAAATAGAGAAAGGGGAAGG - Intergenic
910252932 1:85217219-85217241 TTCCAGAAGGAAAAAGAGTATGG + Intergenic
910287421 1:85571170-85571192 TTTCAGAAGGGGAAAGAGAAGGG - Intronic
910802770 1:91162250-91162272 TGACAGAAGGAGGCAGAGGAGGG + Intergenic
910807877 1:91206634-91206656 TTACAGATGGAGCAATGGTAAGG + Intergenic
910840714 1:91558794-91558816 TTAAAGAATGAATAAGGGGAAGG - Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911245057 1:95507762-95507784 TTACAGGAGTAGGAAGGGGCTGG - Intergenic
911248902 1:95552554-95552576 TTTGAGAAGATGAAAGGGGACGG - Intergenic
911431941 1:97800791-97800813 CTACAGAAGGTGGAAGGAGATGG - Intronic
911521018 1:98930914-98930936 TTCAAGAAGGAGGAAGGTGATGG + Intronic
911591260 1:99750756-99750778 TTCCAGAAGGAGAAGAGGGAAGG + Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
911975426 1:104488780-104488802 TTACAGAAGGAGGTTGGGTAAGG - Intergenic
912130653 1:106595804-106595826 TTACAGAAGGGGAGAGGACAAGG + Intergenic
912406608 1:109443885-109443907 TCACTGTAGGGGAAAGGGGAAGG + Intergenic
914417583 1:147498204-147498226 TTGCTGAAGGGGAAAGGGCAGGG - Intergenic
914691255 1:150030194-150030216 TTTGAGAAGGAGCAAGGTGATGG - Intergenic
914835666 1:151204725-151204747 TGACAAAAGGAAAAAGGGGTGGG - Intronic
916165219 1:161960832-161960854 TTACAGAATGGGAAGGGGCAGGG - Exonic
916425270 1:164674268-164674290 TTACACATGGACAAAGAGGAAGG + Intronic
916460956 1:165023742-165023764 TGGCAGAAGGTGAAAGGGTAAGG + Intergenic
916858709 1:168779508-168779530 TTCCACAAGGAGACAGGGGAGGG - Intergenic
917360358 1:174168643-174168665 ATACAGAAGGAAAAAAGGAATGG - Intronic
917985188 1:180309551-180309573 TGAAAGAAGGAATAAGGGGATGG + Intronic
918032568 1:180829874-180829896 TTAAATAAGGAAAAAAGGGATGG - Intronic
918051190 1:180973927-180973949 GTACAGAAGGCTAAAGGGGTAGG + Exonic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918712885 1:187753110-187753132 TAACGGAAGAAGAAAGAGGAGGG - Intergenic
918915180 1:190626423-190626445 TTACAAAAGGAAACAGAGGAAGG - Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919037843 1:192338951-192338973 TTGCATAACTAGAAAGGGGAAGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
921329304 1:214019644-214019666 GTACACAAGGTGACAGGGGAGGG - Intronic
921475282 1:215599775-215599797 TTACAGAAGGAGAAGTAGCAAGG + Intronic
921852435 1:219945627-219945649 TTGCAGAAGGAGAAAGTACAAGG + Intronic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922145855 1:222943545-222943567 TTGCAGACAGGGAAAGGGGAAGG - Intronic
922469790 1:225868952-225868974 CTACAGAGGGAGAAGGGGCAGGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
1063441069 10:6073642-6073664 TCACAGAAGTAGAAAGTAGAAGG - Intergenic
1063863923 10:10343409-10343431 TTACAGAAGGAGAAATCTAATGG + Intergenic
1063985923 10:11501798-11501820 GAAAAGAAGGAGAAAGGGCAGGG - Intronic
1064756351 10:18574981-18575003 TTACAGTAGGAGGAGGGAGATGG - Intronic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1064982635 10:21179781-21179803 TTGAAGACGGAGGAAGGGGAAGG + Intergenic
1065317966 10:24483155-24483177 TTACAGCAGGAGAAACAGCAAGG + Intronic
1065325019 10:24543176-24543198 TTACGGAAAGACAAAGGAGATGG + Exonic
1065736559 10:28758290-28758312 AGACAGAAGGAGGAAGGAGAAGG - Intergenic
1066063518 10:31745181-31745203 GAAGAGAAGGAGCAAGGGGAGGG - Intergenic
1066203993 10:33169670-33169692 GTGCAGAAGGAAAAAGGGGAAGG + Intergenic
1066334657 10:34463283-34463305 GAACAGAACAAGAAAGGGGAGGG + Intronic
1067841910 10:49687909-49687931 TTTAAGAAGGAGAAATGGCAGGG + Intronic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1069074736 10:64026970-64026992 TTGCAGATGGAGGAAGGGAATGG - Intergenic
1069785973 10:70988178-70988200 TGACAGAAGGCTAAAGGGTAGGG - Intergenic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070368249 10:75757194-75757216 TAGCAGAAGGATAAAGGAGAGGG - Intronic
1070543289 10:77432845-77432867 TTACAGAGGGGGAAGGGGCAGGG + Intronic
1070729677 10:78817828-78817850 TTACACAAGGAGAAATGGTTGGG + Intergenic
1070851228 10:79562874-79562896 GTGCAGCTGGAGAAAGGGGAAGG - Intergenic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071441620 10:85702964-85702986 AGACAGAAGGAGAAAGGAGGAGG + Intronic
1071712313 10:88061573-88061595 TTATAAAACGAGAAAGGGGCCGG - Intergenic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1073339806 10:102735979-102736001 GTCCAGAAGGAGACAGGGAAGGG + Intronic
1073673323 10:105616942-105616964 TGACTGAAGGAGAAAGGTGGAGG - Intergenic
1073712273 10:106057206-106057228 ATAAAGAAGGGGAAAGGGAAAGG - Intergenic
1073776516 10:106791921-106791943 TGACAAAAGGATAAAAGGGAGGG - Intronic
1073847583 10:107576305-107576327 TTATAGACAGAGAGAGGGGAAGG + Intergenic
1074311437 10:112326428-112326450 TTACAGAAGGACAAGGGGGATGG - Intergenic
1074723014 10:116279793-116279815 GTACAGAAGGATCAATGGGATGG + Intergenic
1074931196 10:118127933-118127955 TGACAGATGGAGGAAGGGGAAGG - Intergenic
1075607741 10:123826377-123826399 TAACAGCAGAAGAAAGGGAAGGG + Intronic
1075653361 10:124144899-124144921 TTACAGATGGAGAGAGGAAATGG + Intergenic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076233427 10:128842260-128842282 TTCCAGAAGGAGAGAAAGGACGG + Intergenic
1076538643 10:131199250-131199272 GTACAGAATGAGAAGGGGGTTGG - Intronic
1077300139 11:1842966-1842988 CTACAGAAGGCTAAAGGAGAAGG - Intergenic
1077890723 11:6416322-6416344 TTATAGGATGAGAAAGAGGAAGG - Intronic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078652909 11:13212606-13212628 TTACAGAGTAAGAAAAGGGAGGG + Intergenic
1078695763 11:13629588-13629610 TTACTTATGGTGAAAGGGGAAGG - Intergenic
1078708482 11:13767701-13767723 TTAGAGCAGATGAAAGGGGAGGG + Intergenic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079338223 11:19589850-19589872 GTAGAGAAGGAGAGAGGGAAGGG + Intronic
1079802611 11:24889103-24889125 TTACAGAAGCCAAAAGGGGATGG + Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1081236010 11:40647919-40647941 TTACAAAAGGAGAAAGCAGGGGG - Intronic
1081949852 11:47034955-47034977 TTAAAGCAGAAGAAAGGTGAAGG - Intronic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082673697 11:56069090-56069112 TTACAGAAGGAGGATGATGAAGG + Intergenic
1082862551 11:57869795-57869817 TTACTCATGGAGGAAGGGGAAGG + Intergenic
1083054086 11:59803085-59803107 CAACAGAAGGAAAAAGGAGATGG - Intergenic
1083604401 11:63969271-63969293 CTACAGAAAGAAACAGGGGATGG - Intergenic
1084093086 11:66892091-66892113 TTATAGGAAGAGGAAGGGGAAGG + Intronic
1084516717 11:69641673-69641695 TTTCTGAAGGAGGAAGGGGTGGG + Intronic
1085958867 11:81435680-81435702 TGAAACAAAGAGAAAGGGGATGG - Intergenic
1086218065 11:84407236-84407258 TTAAAAAGGGAGAAATGGGAGGG - Intronic
1086290308 11:85301231-85301253 TTAGAGAAGGACAAAGAGAATGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086700347 11:89894714-89894736 TTTCAGAAGAAAAAAGGGGAGGG - Intergenic
1086705823 11:89949812-89949834 TTTCAGAAGAAAAAAGGGGAGGG + Intergenic
1087055851 11:93935578-93935600 TTACAGAAGCAGAACTGGCAAGG - Intergenic
1087681984 11:101228551-101228573 TGGCAGAAGGGGAAAAGGGAGGG + Intergenic
1087821458 11:102717389-102717411 TTCAAGAAGAAGAAAGGGAATGG - Intronic
1088015382 11:105052202-105052224 TTAAAGGAAAAGAAAGGGGAAGG - Intronic
1088510824 11:110572920-110572942 TTCCAGAAGGAGAGAGCGTAAGG - Intergenic
1088611272 11:111579648-111579670 TTGCAAGAGGAAAAAGGGGATGG - Intergenic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088713602 11:112529424-112529446 TGAAAGAAGGTGAAAGGGAAGGG + Intergenic
1088800957 11:113306736-113306758 TTAGAGAAGGAGGAAGCTGAAGG - Intergenic
1088817336 11:113430598-113430620 AGACAGAAGGACAAAAGGGAGGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089798956 11:121007804-121007826 TAACAGAAGGAGAAAGGGGCTGG + Intergenic
1090363455 11:126188553-126188575 TTTCAGGAGGAGAGAAGGGAGGG - Intergenic
1090494448 11:127196211-127196233 GTACACAAGAAGAAAGGAGAAGG - Intergenic
1090542202 11:127719936-127719958 TGAGAGAAGGAGCAAGGGCAGGG + Intergenic
1090716506 11:129436610-129436632 GTACAGATGGAGGAAGGGGAAGG - Intronic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1091044135 11:132310746-132310768 TTACTGTAGGAGAAAAGAGAAGG + Intronic
1091272453 11:134327177-134327199 GTGCAGACCGAGAAAGGGGATGG - Intergenic
1091607114 12:1963018-1963040 TTACAGAAAGTGAAAGTGGGTGG - Intronic
1091629934 12:2152420-2152442 CTGCAGAGGGAGAAAGGGAAAGG - Intronic
1092514538 12:9195409-9195431 GAAAAGAAGGAAAAAGGGGAAGG - Intronic
1092913969 12:13172840-13172862 GGATAGATGGAGAAAGGGGAAGG - Intergenic
1092954026 12:13532765-13532787 TTTCATAGGGAGAATGGGGAGGG + Intergenic
1093760479 12:22903923-22903945 TTACAGAAGAAGAGAGTTGAAGG + Intergenic
1094013291 12:25832167-25832189 CTACAGAAGGAAAAAAAGGAAGG - Intergenic
1094244421 12:28272369-28272391 TTCCAGAAGGAGAAAGAGAATGG - Intronic
1094745623 12:33341345-33341367 GCACAGAAGGAGAGAGGAGAAGG - Intergenic
1094789908 12:33900543-33900565 ATATAGGAGGAGAAAGGAGAAGG - Intergenic
1095085721 12:38056012-38056034 TTTCTGAAGGGGAAAAGGGAAGG - Intergenic
1095227304 12:39693386-39693408 TTGCAGAAGGAAATAGGGCAGGG - Intronic
1095701172 12:45192713-45192735 TTATAGAATGATAACGGGGAGGG - Intergenic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1095863578 12:46947220-46947242 TGAAGGAAGGAGAAAGGGGAAGG - Intergenic
1095940814 12:47725558-47725580 TTTCAGGAAGAAAAAGGGGAGGG + Intronic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096574730 12:52545561-52545583 TTACAGATGCTGACAGGGGAGGG + Exonic
1097197963 12:57254728-57254750 TCACAGAAGGAGCAAGGGCAGGG - Exonic
1097589204 12:61552925-61552947 TTACTGCAGGAGAAAGGGTAAGG - Intergenic
1097730962 12:63127499-63127521 CTACAGAAGTTGAAATGGGAAGG - Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099357190 12:81652585-81652607 TTACAGAAGGAAAGACGGGGAGG - Intronic
1099478145 12:83133241-83133263 TTACATAAGGATAAAGGACAGGG + Exonic
1099521274 12:83666610-83666632 TTACAGAAGGAGGAAGAATATGG + Intergenic
1099587826 12:84544278-84544300 TTAATGAAGGAGAAAGCTGAGGG - Intergenic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100241745 12:92716515-92716537 TTACAGAATGAGAGAGGGAATGG - Intergenic
1100467548 12:94860511-94860533 TTACAGAAGTAGTAAGGGCAAGG - Intergenic
1100504239 12:95204395-95204417 TTAGCAAAGGAGAACGGGGAGGG + Intronic
1101423672 12:104569882-104569904 TTACAGTTGGAGGAAGAGGACGG + Intronic
1101481308 12:105100331-105100353 GGAAAGAAGGAGAAAGAGGAAGG - Intergenic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101721927 12:107357998-107358020 GAACAGAAGGAGAAAGGAAAGGG - Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102791846 12:115653110-115653132 TTACAGAAGCAGAAATAGAAGGG - Intergenic
1103026351 12:117577346-117577368 TTACAGAAGGAGAGAGAGAGAGG + Intronic
1103426022 12:120834593-120834615 TTGCAGAAGGAGTATGGCGACGG - Intronic
1103516779 12:121513437-121513459 TTCCAGAGGGCGAAGGGGGAAGG + Intronic
1103680752 12:122691654-122691676 TTACAGAAGTAAAGTGGGGAAGG + Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104261470 12:127187125-127187147 TAACGGAAGGTGAAAGGGTATGG - Intergenic
1104611483 12:130232122-130232144 AGACAGAAAGAGCAAGGGGAGGG - Intergenic
1104754911 12:131262929-131262951 AGAAAGAAGGAGAAAGGGCATGG + Intergenic
1105626641 13:22119424-22119446 TCACAGAAGGAGAAAAAAGATGG + Intergenic
1105972288 13:25440323-25440345 TTAGCAAAGGAAAAAGGGGAAGG - Intronic
1106033191 13:26020804-26020826 TTACAGAACGAGAAGGGCGGTGG - Exonic
1106674265 13:31941191-31941213 TTCCTGATGGAGAGAGGGGATGG - Intergenic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1107033972 13:35881423-35881445 TTAGAGAAGAAAAAAAGGGAAGG - Intronic
1108252132 13:48577925-48577947 TCTCAGAAGGAGGAAGGGAAGGG - Intergenic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108552945 13:51564714-51564736 CTACAGATGAAGAAAGGGCAGGG + Intergenic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109057133 13:57564998-57565020 TGACAGAAGAAGCAAGGGGGTGG - Intergenic
1109600918 13:64627456-64627478 TCAGAGAAGGAGCAAGGGGTGGG - Intergenic
1109613956 13:64806791-64806813 TTAGAGAAGAAGAAAGGAGGTGG + Intergenic
1109860126 13:68187540-68187562 TTATTGAAGGAGGATGGGGAGGG - Intergenic
1109897344 13:68711033-68711055 TTACAGCAGTAGAAAGTGGCAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110326560 13:74223064-74223086 TTACAGAAGGGAAAAGGGTGAGG - Intergenic
1110640113 13:77813874-77813896 TTATGGAAGGAGTAAGTGGAGGG - Intergenic
1110877787 13:80531814-80531836 TTACAAAAGGAGTAAGGGTAGGG - Intergenic
1111711173 13:91816191-91816213 TTACAGTAGCAGAAGGGTGAGGG - Intronic
1112027484 13:95424945-95424967 TTACAGAAAGAGATAAAGGATGG + Intergenic
1112096699 13:96140849-96140871 TTAAAGAAAAAGGAAGGGGAAGG + Intronic
1112630700 13:101158452-101158474 GCAGAGAAGGAGAAAGGGGTGGG + Intronic
1113025734 13:105938916-105938938 TTGAAGAATGAGAAAGGTGAAGG - Intergenic
1114449786 14:22817931-22817953 GCAAAGAATGAGAAAGGGGAGGG - Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114553523 14:23548150-23548172 TTACAGAATGTGAAAGGAGAAGG - Intronic
1114769521 14:25412345-25412367 TTCCAGAATGAGATAGGGGGAGG - Intergenic
1115206580 14:30912710-30912732 TTACAGATGGAGAAATGTGAAGG - Intronic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1116169654 14:41384023-41384045 TTACAGAAGCAGTAAGGGAGAGG + Intergenic
1116331706 14:43604894-43604916 TTACAGCAAGAGAAAGGAGTAGG + Intergenic
1116787478 14:49303544-49303566 TTCCACAAGAAGGAAGGGGAGGG + Intergenic
1116802309 14:49455559-49455581 TTAAAGATGGAGAAAGGGACAGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117500770 14:56348955-56348977 TTTAAAAGGGAGAAAGGGGAAGG + Intergenic
1117883473 14:60334841-60334863 CTCCAGAAGGATCAAGGGGAGGG + Intergenic
1118346431 14:64944502-64944524 TCACACCAGGAGAAAAGGGATGG - Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119763625 14:77173537-77173559 TTACAGGAAGATAAAGAGGATGG - Intronic
1119891757 14:78188080-78188102 TTAGAGATGGAGAAACAGGATGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120396335 14:83971445-83971467 GAAAAGAAGGAGGAAGGGGAGGG + Intergenic
1120736651 14:88060552-88060574 TTTAAGAAGGAAAAAGGGGAGGG - Intergenic
1120975238 14:90242501-90242523 TTACAGAGGGAGAAATGAAATGG + Intergenic
1121051686 14:90823035-90823057 ATTCAGAACGAGAGAGGGGAAGG + Intergenic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1121576652 14:94994381-94994403 GTACAGCAGGAGAAAGAGGAAGG - Intergenic
1121669601 14:95698078-95698100 TTTCAGGAAGAGAAAGGAGAAGG - Intergenic
1121774028 14:96578414-96578436 TTCAAGAAGGATGAAGGGGAGGG + Intergenic
1121892993 14:97615164-97615186 TTCCAGAAGGAGAAAAGAGGGGG - Intergenic
1121902713 14:97708578-97708600 AAACAAAAGGAGAGAGGGGAGGG + Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123466023 15:20516469-20516491 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1123652091 15:22484570-22484592 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1123742511 15:23293430-23293452 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123760814 15:23431056-23431078 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1123771018 15:23529217-23529239 TGACAGAAGAAAAAAAGGGAAGG - Intergenic
1123890645 15:24775001-24775023 TTACAGAAGGAAATAGCAGAAGG + Intergenic
1124036217 15:26055568-26055590 TTATTGATGGAGAAAAGGGATGG + Intergenic
1124268293 15:28257024-28257046 TTACAAAAGGAGGAAGAAGAAGG + Intronic
1124276747 15:28332445-28332467 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1124305953 15:28579161-28579183 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124385408 15:29204337-29204359 TTACAGAAGTACAAATGGGATGG + Intronic
1124986429 15:34620641-34620663 TTACAGTAGCAGAACGGTGAGGG - Intergenic
1125824688 15:42666399-42666421 TTACATAGGGAGAAGGGGTAAGG + Intronic
1126238092 15:46409105-46409127 CAACATATGGAGAAAGGGGATGG - Intergenic
1126916972 15:53476836-53476858 TTACAGAAGTACACAGGGCAGGG + Intergenic
1127109897 15:55657384-55657406 ATTCAGATGGAGAAAGGTGAAGG + Intronic
1127273083 15:57418516-57418538 TTACAGAAGGAAGAAGGAGCAGG - Intronic
1127714937 15:61640750-61640772 TTACAGAAGGGGCAAAGGGCAGG + Intergenic
1127964610 15:63914348-63914370 GTACAGAAGGAAAGAGAGGAGGG + Intronic
1128514316 15:68332680-68332702 TGACAGAAGGAAAAGAGGGAAGG - Intronic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129187489 15:73918820-73918842 TTACAGAAAGAAAAAAGGCATGG + Intergenic
1129360070 15:75019075-75019097 GTAGGGAAGGAGAAAAGGGAAGG - Exonic
1130090814 15:80819713-80819735 TTAGAGAAAGAGGAAGGGAATGG + Intronic
1130091304 15:80823549-80823571 TTACAGAAGGGGAAAGGGACTGG - Intronic
1130102781 15:80906511-80906533 TTACAGAAGGATGAAGGTCAGGG - Intronic
1130149892 15:81303576-81303598 TTACACAAGGAGGAAGGTGCTGG + Exonic
1130236121 15:82135313-82135335 TTTCTGAAGGATAAAGGAGACGG + Intronic
1130451809 15:84062318-84062340 TTCCAAAAGGAGAAAGGGAGAGG - Intergenic
1130662920 15:85844769-85844791 TTTCAGGAAGAGAAAGGGAAGGG + Intergenic
1130725372 15:86433383-86433405 TTCTAGAAGGAGGAAGGTGAAGG + Intronic
1131841693 15:96444079-96444101 TGACAGAAGGGGAAAAGGGATGG + Intergenic
1131973702 15:97919480-97919502 TCACAGAAGGAGAGATGGGTGGG + Intergenic
1132112693 15:99114067-99114089 TTACAGAACTGGAAAGTGGAGGG + Intronic
1133131822 16:3680807-3680829 ATACAGAAGGTGGAAGGGGCAGG - Intronic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133420519 16:5642695-5642717 TTACAGAAGGAGGGAGGGGGAGG + Intergenic
1133431006 16:5736721-5736743 ACACAGATGGAGAGAGGGGAGGG - Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134658439 16:15965586-15965608 TTAAAAAGGGAGAAAGGGGCTGG - Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134787141 16:16954863-16954885 TTACAAATGGAGGAAGGGTAGGG + Intergenic
1135104105 16:19632438-19632460 TTACAGGGAAAGAAAGGGGAAGG - Intronic
1135500637 16:22992889-22992911 TTAGAGAATGCCAAAGGGGAAGG - Intergenic
1135534111 16:23279432-23279454 TTACACAAGGAGGAGGGTGAGGG + Intronic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1135978164 16:27124749-27124771 TTACAGAAGCAGAAAGGGGTGGG + Intergenic
1136179602 16:28542050-28542072 TGAGAGAAGGAGGAAGGGCATGG + Intergenic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1137066395 16:35849899-35849921 TACCTGAAGGAGAAAGGAGAGGG - Intergenic
1138124841 16:54430244-54430266 TGGCAGAAGGAGAAAGGACAAGG + Intergenic
1139097143 16:63718155-63718177 CTACACAAGTAGAAAGGTGAGGG - Intergenic
1139127887 16:64103306-64103328 ATACAGAAGGACAAGCGGGATGG - Intergenic
1139477615 16:67210504-67210526 TTGCAGAAGGAGAACTGGGCGGG + Exonic
1139531338 16:67544133-67544155 TTCCAGAAGGAGGAAGGGGCTGG - Intronic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1139775474 16:69314297-69314319 TTCCAAAAGGAGGGAGGGGATGG + Intronic
1140590847 16:76350907-76350929 TTAAGGTAGGAGAAAGAGGACGG + Intronic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1140914707 16:79483183-79483205 GGACAGAAGGAGGGAGGGGAGGG - Intergenic
1141469375 16:84228356-84228378 TCACAGCAGGAGGGAGGGGAGGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1142882514 17:2892876-2892898 TCCCAGAAAGAGAAAGGGGAGGG - Intronic
1143462563 17:7113181-7113203 TTACAGAAGGATCCAGGGAAGGG + Intronic
1143633848 17:8153227-8153249 CTACAGAGGGACCAAGGGGATGG + Intronic
1144100888 17:11941331-11941353 GGACAGAGGGAGAGAGGGGAAGG - Intronic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1145108125 17:20137234-20137256 AGACTGAAGAAGAAAGGGGACGG - Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145920709 17:28607257-28607279 TTAAAGAAAAGGAAAGGGGAAGG + Intronic
1146032148 17:29375452-29375474 TTACAGATGGGGAAAGGTGAGGG + Intergenic
1146224305 17:31052314-31052336 TTCCAGAAAAAGAAAGGTGACGG - Intergenic
1146386910 17:32385061-32385083 TAACAGAATGAGAAACGGGCCGG - Intergenic
1146455219 17:33004418-33004440 GAAGAGAAAGAGAAAGGGGAAGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146624623 17:34425822-34425844 TTAAAGTAGGAGGAAGGGGTAGG - Intergenic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147756019 17:42768510-42768532 TTAAAGAATGAGAAAAGGGCTGG + Intergenic
1147830950 17:43297906-43297928 GTAAGGAAGGAGAAAGGGAAAGG - Intergenic
1148208124 17:45792264-45792286 TGGCAGAAAGAGGAAGGGGAAGG - Intronic
1148508491 17:48147607-48147629 TTCCAGAAGGAGAAAGGAAATGG + Intronic
1148545434 17:48515151-48515173 TTCCAAAAGGAAAAAGAGGAGGG + Intergenic
1150367709 17:64604977-64604999 TTGGACAAGGAGAAAAGGGAGGG - Intronic
1150468736 17:65417617-65417639 TTACAGAAGGGAAAACGGAACGG + Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151257108 17:72886438-72886460 TGAGAGAAGGAGAAAGGAGGAGG - Intronic
1151375793 17:73687970-73687992 TTTCAGAAGGAGAACTGGGCAGG + Intergenic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1153143341 18:2000365-2000387 TCAAAGAAGGAGATAGGAGATGG + Intergenic
1153996145 18:10443387-10443409 TTACAAAAGCAGAAATGGGATGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155729495 18:29135375-29135397 TAAAAGAAAGAGAAAGGGAAAGG + Intergenic
1157523335 18:48360562-48360584 GGACAGAAGGAGCCAGGGGAGGG + Intronic
1158080169 18:53580939-53580961 TTACAGGAAGAGAAAGAGGAAGG + Intergenic
1158330414 18:56356389-56356411 TTTCAGAAGGTGAAAGACGATGG - Intergenic
1158490964 18:57909457-57909479 TGTGAGAAAGAGAAAGGGGAAGG - Intergenic
1159386118 18:67727126-67727148 TGACAGATGGAGACAAGGGAAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1160042325 18:75357133-75357155 TGGCAGAAGGATGAAGGGGAAGG - Intergenic
1160063551 18:75553304-75553326 CTTCAGAAGGAGAAAGGGATGGG + Intergenic
1160442786 18:78905037-78905059 TTACAGATGGAGAAGGAGGGTGG - Intergenic
1160600631 18:80010043-80010065 TTACAGCAGGAGCCAGGGAAAGG - Intronic
1161556652 19:4946440-4946462 TCACAGCAGTCGAAAGGGGAAGG - Intronic
1161799236 19:6406613-6406635 TTAGGGAAAGAGAAAAGGGAAGG - Intergenic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1161982114 19:7635396-7635418 TTACAAAAGGAGGAAGGGGCAGG + Intronic
1162751442 19:12832500-12832522 TTAGGGAAGGAGAAAGGGTGCGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163351252 19:16777676-16777698 GGAGGGAAGGAGAAAGGGGAGGG + Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164400046 19:27896116-27896138 TTACAGAAGGTGAAGGAGGCAGG - Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164649895 19:29884195-29884217 GGAGAGAAGGAGGAAGGGGAGGG - Intergenic
1164835487 19:31352649-31352671 TTACAAAGGGAGAAAGGGCAGGG + Intergenic
1165122690 19:33571196-33571218 TTACAGAAGAAGGAAGAGAAAGG + Intergenic
1166333228 19:42090645-42090667 TTCCAGAAGGTGAAAGAGAAAGG - Exonic
1166437927 19:42785420-42785442 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166456881 19:42949212-42949234 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166472965 19:43096159-43096181 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166493746 19:43283145-43283167 TCACAGACGGAGAAAGAGGAGGG - Intergenic
1166577722 19:43858511-43858533 TTCCAGAAGGAGAAAGTTGAGGG + Intergenic
1166933941 19:46319888-46319910 TTACAGAAGGAGCTTGGGAAGGG + Intronic
1167390899 19:49194252-49194274 TCAAAGAAGAAGAAAGGAGAAGG - Intronic
1167486530 19:49766487-49766509 GTAGAGAAGGAAAGAGGGGAGGG - Intergenic
1168081298 19:54012336-54012358 TTACAGAGGGAGAAAGGATAAGG - Exonic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925150576 2:1612110-1612132 TTAGAGGAGGAGAAGTGGGAAGG - Intergenic
925253294 2:2460896-2460918 TTCCCCAAGGAGAAAAGGGATGG - Intergenic
925325753 2:3020621-3020643 TTACAGGAAGAGCTAGGGGAGGG + Intergenic
927105622 2:19821140-19821162 TCACTGCAGCAGAAAGGGGAGGG + Intergenic
927448672 2:23187777-23187799 TTCCACAAGGAGGAAGGGAAAGG + Intergenic
928449240 2:31364246-31364268 TGATAAAAGGAGAAAGGAGAGGG + Intronic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
929872184 2:45768483-45768505 TTACAGAAGGAAAAGAGGGAAGG - Intronic
930421409 2:51157684-51157706 TCCCAGAAGGAGGTAGGGGAAGG - Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
931238312 2:60430530-60430552 GTCCAGAAGGAGAACTGGGAGGG - Intergenic
931541229 2:63331238-63331260 ATACTCAAGGAAAAAGGGGATGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
932040531 2:68294529-68294551 CTACAGAAGGGGAATGGCGAAGG + Intronic
932261177 2:70329020-70329042 TTACAGAGGGAGCAAGCTGACGG - Intergenic
932450024 2:71803585-71803607 AAACAGCAGGGGAAAGGGGATGG - Intergenic
932540450 2:72646381-72646403 TTTCAGAAGGAAAGAGGAGATGG - Intronic
932754772 2:74399691-74399713 TAAAAGAAGGAAAAAAGGGAGGG + Intergenic
932947520 2:76253746-76253768 TTACAGAAATAGAAAGTAGAAGG + Intergenic
933101393 2:78262720-78262742 TTACAGAAGTACAATGAGGAGGG + Intergenic
933687150 2:85151402-85151424 TTAAAAAAGGAGAGAGGGAATGG - Intronic
933907773 2:86912623-86912645 TTACAGAAGTAGGAGAGGGAAGG + Intronic
933909021 2:86922338-86922360 TTACAGAAGTAGGAGAGGGAAGG + Intronic
933928612 2:87124918-87124940 TTACAGAAGTAGGAGAGGGAAGG + Intergenic
933999947 2:87700704-87700726 TTACAGAAGTAGGAGAGGGAAGG + Intergenic
934023703 2:87981047-87981069 TTACAGAAGTAGGAGAGGGAAGG - Intergenic
934473551 2:94577411-94577433 TTACAGTAGGGGGAGGGGGACGG + Intergenic
934745948 2:96759985-96760007 TTACAGATGGAGAAATGGGCTGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935681759 2:105644396-105644418 TTACAGCATGAGAAATTGGAGGG + Intergenic
935867583 2:107407629-107407651 GAAGAGAAAGAGAAAGGGGAGGG - Intergenic
937036453 2:118786349-118786371 TTACAGAAGAGGAAAAGGCAAGG + Intergenic
937636969 2:124166960-124166982 TTAAAGAAGAAAAAAAGGGAAGG - Intronic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938938939 2:136152245-136152267 GGAAAGAAGGAGAAATGGGAAGG - Intergenic
939159772 2:138574139-138574161 TTACAAAAGGAACAAGGGGGTGG - Intergenic
939280973 2:140064425-140064447 TTACAGAGTGAGAAAGCAGATGG + Intergenic
939872875 2:147544450-147544472 TTGTAGCAGGAGAAAGGGGGTGG - Intergenic
940463890 2:154003816-154003838 TCACAGAAGGAGGAAGAGGAGGG - Intronic
941089829 2:161161167-161161189 TTCTAGAAGTAGAAAGGGGGAGG + Intronic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941141103 2:161782891-161782913 TTCCAGAAGGAGAAGAGAGAAGG + Intronic
941226723 2:162858664-162858686 TCACAGAGGGAGACAGGTGAGGG + Intergenic
942062482 2:172240542-172240564 TTCCATCAGGAGAATGGGGAAGG + Intergenic
942279376 2:174344395-174344417 TGAAGGGAGGAGAAAGGGGAAGG + Intergenic
943174998 2:184460881-184460903 TTTCAGAGAGAGAAAGAGGAAGG + Intergenic
943445297 2:187977876-187977898 TTGCAGGAGGAGGAAGGGAAAGG + Intergenic
943645323 2:190403804-190403826 TTGCAAAAGGGAAAAGGGGAAGG - Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
944685099 2:202111017-202111039 TCACACAAGTATAAAGGGGAGGG - Intronic
944740794 2:202610535-202610557 TTACAGAATTTGAAAGGGCAAGG + Intergenic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946105668 2:217367559-217367581 CTACAGCTGGGGAAAGGGGAAGG - Intronic
946172411 2:217903313-217903335 TTACAGATGGACAAATGAGACGG - Intronic
946610239 2:221449943-221449965 TTAAAGAAGGAGAAAAAGAATGG - Intronic
946623811 2:221589758-221589780 GTCCAGATGGAGAGAGGGGATGG + Intergenic
946802250 2:223431393-223431415 ATACAGTAGGATAAAGGGAAAGG + Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947330704 2:229026362-229026384 TTAAAAAAGGAGTAAGGAGAGGG - Intronic
947373153 2:229468783-229468805 TTACAGAAGGAGCCTGGAGAAGG + Intronic
947544273 2:231000337-231000359 GGACAGAAGGAGAGAGGTGAGGG - Intronic
948313775 2:237010992-237011014 TTACAGATGAGGAATGGGGAGGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948995500 2:241576247-241576269 AGACAGGAGGAGGAAGGGGAGGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169002952 20:2181395-2181417 TCAAAGAAGGAAGAAGGGGATGG + Intergenic
1169178318 20:3539314-3539336 TTTTAGGAGGAGAAAGGGTAGGG + Intronic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1169303516 20:4468202-4468224 TGAAAGATGGAGAAAGGTGATGG + Intergenic
1169484265 20:6013455-6013477 TCACAGAAGGTGAGAGGGCATGG + Intronic
1170424110 20:16221150-16221172 TTACAGCAGGAGGAGGGAGAGGG + Intergenic
1170631347 20:18068928-18068950 TCATAGAAGGAGAAAGTAGAAGG - Intergenic
1172373354 20:34414835-34414857 CTACAGAAGTAGAAGGGGAATGG - Intronic
1172624829 20:36340974-36340996 TTCCAGGAGGAGCATGGGGAGGG - Intronic
1172871684 20:38139656-38139678 TGGCAGAGGTAGAAAGGGGAAGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173544031 20:43878698-43878720 ATAGAGAAAGACAAAGGGGAAGG - Intergenic
1173694386 20:44996196-44996218 TTCTAGAAGGAGACAGGGGTTGG - Intronic
1174094042 20:48073834-48073856 GGACAGAAGGAGGATGGGGAAGG - Intergenic
1174148671 20:48470272-48470294 TCACAGAAGGGGAAATGTGAAGG + Intergenic
1174513826 20:51076032-51076054 TTCCAGATGGAGAAAGAGGGTGG + Intergenic
1175064857 20:56276070-56276092 GTAGAGAGGGAGAAAGGAGAGGG - Intergenic
1175287435 20:57846321-57846343 TTAGAGAATGAGAAAGAGTATGG - Intergenic
1175687269 20:61040749-61040771 TTAGAAAAGGTGAAAGGGAAGGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175912681 20:62412304-62412326 TGAGAGAAGGAGCCAGGGGATGG - Intronic
1177297624 21:19197540-19197562 TCACAGAAGAAGAGATGGGAAGG - Intergenic
1178058114 21:28821868-28821890 TAACAAATGGAGAAAGGGCAAGG - Intergenic
1178155326 21:29846692-29846714 TTAAAGAATGAGAAGGGAGAAGG + Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178243554 21:30930259-30930281 TTACAGCAGGAGATAGGGCATGG - Intergenic
1178931674 21:36824437-36824459 TCAGAGAAGGGAAAAGGGGAGGG + Intronic
1179020902 21:37640054-37640076 TTACAGAAGGAGACACAGGAAGG - Intronic
1179068848 21:38053048-38053070 TTTCAGAGGAAGGAAGGGGATGG + Intronic
1179145082 21:38760988-38761010 TGAAAGAAGGAGAAAGGGAGAGG - Intergenic
1179440152 21:41387926-41387948 TGAGAGGAGGAGAAAAGGGAGGG - Intronic
1180085678 21:45507020-45507042 TGACAGGAGGAGGCAGGGGATGG + Intronic
1182737087 22:32538576-32538598 TTACTGGAGCAGAAAGGGCAAGG - Intronic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
1184262431 22:43326708-43326730 TCACAGAGTGGGAAAGGGGAGGG - Intronic
1184883823 22:47329821-47329843 GAGCAGAAGGAGGAAGGGGAGGG + Intergenic
949094645 3:71632-71654 TTACAGAATAGGGAAGGGGAGGG - Intergenic
949391396 3:3566316-3566338 TTACAGTAGGAGAAGTGGGCAGG + Intergenic
949496813 3:4640244-4640266 TAATAGCAAGAGAAAGGGGAAGG - Intronic
949523770 3:4882732-4882754 ATAAATAAGGAGAAAGGGAAAGG + Intronic
949896814 3:8773938-8773960 ATACAGAAGGATAAAAGGAAGGG + Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950274150 3:11644040-11644062 GGAAAGAAAGAGAAAGGGGAGGG + Intronic
950289057 3:11768944-11768966 TGACAGATGGTGAAAGGAGAAGG + Intergenic
950856845 3:16113741-16113763 ATTCAGAAGGAGACAGGGTATGG - Intergenic
951265529 3:20561344-20561366 TAACAGAAGGGAAAAGGGCAAGG + Intergenic
951907461 3:27719529-27719551 TTACAAATGGAGAAAGCGGAGGG + Intronic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
953733920 3:45475079-45475101 TGACAGAAGGAGAAATCAGAAGG - Intronic
954212871 3:49108332-49108354 TTAGAGAAGGAGAAGCGGCAAGG + Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955629090 3:60952656-60952678 TTTCAGGAAGAAAAAGGGGAGGG - Intronic
955910824 3:63858527-63858549 TGAGAGATGGAGAAAGGGGTTGG - Intronic
956004868 3:64768115-64768137 TTCCAGAAGGAGAAAGAGATGGG + Intergenic
956340096 3:68212773-68212795 TCAGAGTTGGAGAAAGGGGATGG + Intronic
956385075 3:68708271-68708293 TTACAGAAGTAAAAAGGTAAAGG + Intergenic
956621007 3:71221508-71221530 TTTCAGAAGGAAAGAAGGGAGGG - Intronic
956695227 3:71913094-71913116 TTACAGAAGAAAAAAAGGCAAGG + Intergenic
956721658 3:72123299-72123321 ATACGGCAGAAGAAAGGGGATGG + Intergenic
957013496 3:75035475-75035497 TTTAAGAAGGAGGAAGGAGAAGG + Intergenic
957136623 3:76296548-76296570 TGCCATAGGGAGAAAGGGGAAGG - Intronic
957328495 3:78728183-78728205 TAAAAGAGAGAGAAAGGGGAAGG + Intronic
957334557 3:78810322-78810344 TTACACAGGGAGAAAGAGAAAGG + Intronic
957634721 3:82766173-82766195 TGACAGAAGATGGAAGGGGAGGG - Intergenic
957947061 3:87078465-87078487 TAACAGAAGCAGAAATGGGAAGG + Intergenic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958505246 3:94968280-94968302 TCACAGGAAGACAAAGGGGAGGG + Intergenic
958672541 3:97223058-97223080 TTAAAGCAGGAGAAAGAGCATGG + Intronic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959400150 3:105890937-105890959 ATACAGAAAGCGAAAGGGGGAGG - Intergenic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960251100 3:115454425-115454447 ATACTGAAGGAGAAAAGGTAGGG - Intergenic
960750102 3:120939458-120939480 TTCCAGTAGTAGACAGGGGAGGG - Intronic
961067168 3:123885004-123885026 TTAAAAAAGGGGAAAGGGGAGGG + Intergenic
961131212 3:124468757-124468779 TTAAGGAAAGAGGAAGGGGAAGG + Intronic
961560153 3:127723204-127723226 TCAAAGAGGGAGAAAGTGGAGGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
962981394 3:140493640-140493662 TAACAGAAGGGGGAAGGAGAGGG + Intronic
963003085 3:140701544-140701566 GTCCAGAAGGAGAAGAGGGAGGG - Intergenic
963262933 3:143211065-143211087 TGTCAGAAGGAGAAAGGAGCAGG + Intergenic
963489727 3:145984467-145984489 TTTCTGAAGGAGAAAGAGAACGG + Intergenic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
964622781 3:158732867-158732889 TCCCAGCAGGTGAAAGGGGACGG + Intronic
964646251 3:158961093-158961115 GGAGAGAAGGAGAAAGGGGTGGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965863040 3:173170148-173170170 TTAAAGAAGCAGGAAGGGAAGGG + Intergenic
966457056 3:180129073-180129095 TTACAGCTGGGGAAAGGGAATGG - Intergenic
966736031 3:183187909-183187931 TGACATGAGGAGAAAGGGAAAGG - Intronic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
968530667 4:1089790-1089812 TAACAGCAGGAGAGAGGGCAGGG - Intronic
968546227 4:1200385-1200407 TGACAGAGGGAGCAAGTGGAGGG + Intronic
969162718 4:5275534-5275556 TCACAGAAGGTTCAAGGGGATGG - Intronic
970162338 4:13201573-13201595 TTAGAGTAAGAGGAAGGGGATGG - Intergenic
970743221 4:19263001-19263023 TTAAAAATGGAGAAAGGGGATGG - Intergenic
970962288 4:21886497-21886519 TTACAGAGGGAGTAAGCGGATGG + Intronic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971007343 4:22390119-22390141 GTACAGCAGGAAGAAGGGGAAGG - Intronic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971291820 4:25349519-25349541 TTACAGGAAGATAAAGGCGAAGG + Exonic
971304532 4:25468061-25468083 TTCCAGGAGGAGAAACGGAAAGG - Intergenic
971724705 4:30295701-30295723 TTTCAAAATGAGAAAGGGAAAGG + Intergenic
972070341 4:35011649-35011671 GTACAGAAGAAGAAAGGAGAGGG - Intergenic
972902978 4:43708028-43708050 GGACAGAAGGAAGAAGGGGAGGG + Intergenic
973139594 4:46750115-46750137 TTTCAGAAGGCCAAAGTGGAAGG + Intronic
973300326 4:48575207-48575229 TTAAACAAGGATGAAGGGGATGG + Exonic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975406884 4:73999893-73999915 TAACAGAAGGAGAGAGGGAGAGG - Intergenic
975834204 4:78404553-78404575 ATACAGAAGGAGGAGGGGGTTGG - Intronic
976044098 4:80924141-80924163 TTAAAGGAGAAGAAAGGGGTGGG + Intronic
976069505 4:81224972-81224994 TTGAAGATGGAGGAAGGGGAGGG - Intergenic
976128413 4:81857825-81857847 TTTCTGGAGGAGAAATGGGAAGG - Intronic
976269516 4:83217158-83217180 TTTCAGGGGGAGAAAGGGGCAGG - Intergenic
976501485 4:85795320-85795342 TTCCAGAGGGAGAAAAAGGAAGG - Intronic
978207922 4:106102226-106102248 ATACAGAAGAAGAAAGCTGAAGG - Intronic
978473634 4:109099995-109100017 TTACAGAAGGATTGAGAGGAGGG - Intronic
978539021 4:109795893-109795915 TTACAGAAGGAGAAGAGAAAGGG + Intronic
979006190 4:115300294-115300316 TCACAGAAGCAGAAGTGGGAGGG - Intergenic
979866195 4:125757604-125757626 TTAAAGATGAAGAAAGGGGTGGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
981090935 4:140731394-140731416 TTAAAGAAGGAAAAAGGGCTGGG + Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
983330160 4:166316258-166316280 TGACAGAAGGAGAGAGGGAGGGG - Intergenic
983356725 4:166670418-166670440 TTACAGAGGGAGAAAGAGAGAGG - Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985075382 4:186208938-186208960 GAACAGAAGGAAAAAGGCGAAGG - Exonic
985494710 5:198012-198034 GGGCAGAAGGAGAAAGGGGATGG - Exonic
985760972 5:1748503-1748525 TTACCTATGGAGAAAAGGGAGGG + Intergenic
985819106 5:2147897-2147919 TGACAGCAGGAGGAAGAGGAGGG - Intergenic
986333630 5:6736549-6736571 TTAAAGATGGAGAGAGGGGAAGG - Intronic
986516973 5:8574540-8574562 TTACTCATGGAGAAAGGAGAGGG + Intergenic
986819202 5:11446771-11446793 TTACAGAAGGAGCAAGTGGCAGG + Intronic
987258107 5:16178866-16178888 TCACAGGAAGGGAAAGGGGAAGG + Intronic
989247066 5:39266342-39266364 TTCCACAGGGAGAAATGGGAAGG + Intronic
989345504 5:40425032-40425054 TTAGAGAAGGAGAAAGAGTTTGG - Intergenic
989362288 5:40616027-40616049 TTAAAGGAGGAAAAAGGGAAAGG - Intergenic
990764528 5:59167511-59167533 TCACAGCATGAGAAAGTGGAGGG - Intronic
991392736 5:66165792-66165814 TTAAAGAAGGAGAAAGGATTTGG + Intronic
991685276 5:69176257-69176279 TTACAGATGGAGAAACTTGAAGG + Intronic
991700730 5:69313875-69313897 TTCCAGAAGCAAAAAGGAGAGGG + Intronic
992210687 5:74476971-74476993 TGAAAGAAGGAAAAAGGTGACGG - Intergenic
992553821 5:77884422-77884444 ATACAGAGTGAGAAAGGGAAAGG + Intergenic
993099610 5:83521216-83521238 TTACAGAAAGAGGAATGGTATGG - Exonic
993261850 5:85667672-85667694 GAAGAGGAGGAGAAAGGGGAGGG - Intergenic
993737034 5:91489694-91489716 TCACAGAAGGAGGAAAGAGAAGG - Intergenic
993951690 5:94183581-94183603 TCCCAGAAGGAGAAAAGGGCTGG + Intronic
995092367 5:108193358-108193380 TGACTCAAGGAGAAAGGGAAAGG + Intronic
995237649 5:109848564-109848586 TAACAGGAGGAGAGATGGGAAGG - Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
995661166 5:114484780-114484802 TTAGGGAATTAGAAAGGGGATGG + Intronic
996392378 5:122975143-122975165 TAACAGAAGGAAAAATGTGATGG - Intronic
996529455 5:124512381-124512403 AGACAGAAGGAGAGAGGGGTTGG - Intergenic
997092729 5:130876406-130876428 TTAAACAGGGAGAGAGGGGAGGG - Intergenic
997114637 5:131112780-131112802 GAACAGAAGGAAAAAGGGGGTGG + Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
998026036 5:138817513-138817535 TTCCAGAAGGAGAAAAGAAAAGG - Intronic
998861407 5:146447542-146447564 TTTAAGAAGGGGGAAGGGGAAGG + Intronic
999278098 5:150345800-150345822 TCTCAGAATGGGAAAGGGGACGG - Intergenic
999341783 5:150779147-150779169 TGACAGCAGGAGAAAAAGGAGGG - Intronic
999363992 5:151009424-151009446 TTAAAGAAGGAGGAACGAGAGGG + Intergenic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999448710 5:151662607-151662629 TAATAGAAGAAAAAAGGGGAGGG + Exonic
999524999 5:152395196-152395218 TTACAGAAGGAAAATGGTCAAGG - Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
999542238 5:152586332-152586354 TTTCAGAAGGTTAAAGGAGAAGG + Intergenic
999914367 5:156241555-156241577 TTAAAGAAGGAAAAACTGGATGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000728817 5:164805112-164805134 TTACAGGTTGAGAAAGGGCATGG + Intergenic
1000779488 5:165463936-165463958 TTACAGAAAGAGAACAGAGATGG + Intergenic
1000977112 5:167777073-167777095 TTACAGGAGTAGAAGGGGGAGGG + Intronic
1001156299 5:169275345-169275367 TTACAGCAGTAGAAAGGCTATGG - Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001646099 5:173283443-173283465 TAAGAGAGGGAGAGAGGGGAAGG + Intergenic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1002580464 5:180207290-180207312 TCACTGCAGGAGAAAGGGAAAGG + Intronic
1002587056 5:180255615-180255637 GAACAAAAGGTGAAAGGGGAAGG + Intronic
1002907873 6:1465561-1465583 TTACAGAAAGAAAAAGGGCTTGG + Intergenic
1002952536 6:1829129-1829151 TGAGAGAACAAGAAAGGGGAGGG + Intronic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003202798 6:3977774-3977796 GGACAGAAGGAGAGAAGGGAAGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1004526464 6:16413068-16413090 TTAGAAATGAAGAAAGGGGAAGG + Intronic
1004528447 6:16430912-16430934 TTACAGAAGAAAAAAGAGGCGGG + Intronic
1004828771 6:19453978-19454000 TTGCAGAAGGCTAAAGGGAAAGG - Intergenic
1005033129 6:21530025-21530047 CTGCAGAAGGAGACAGGGCAAGG - Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005575537 6:27186028-27186050 ATACAGAGGGGGAAAGGTGAGGG - Intergenic
1005620732 6:27617779-27617801 TTCCACAAGGGGAAAGGGGCCGG - Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006727018 6:36206849-36206871 TTACAGTTGGAGTCAGGGGAAGG - Intronic
1007050434 6:38822923-38822945 TTACAGAGGAAGAAAGGAGCAGG - Exonic
1007287004 6:40755014-40755036 TTCCAGCAGGAGAGATGGGAAGG - Intergenic
1007478300 6:42133804-42133826 TCATAGAAGGAGACAGGGGCGGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007811915 6:44492260-44492282 TGGCAGAAGGAGAAAGGAGGTGG - Intergenic
1007902735 6:45424836-45424858 TTATAAAAGGAGAAATGTGACGG - Intronic
1007988779 6:46233598-46233620 TAACAGATGGAAAAAGGGGAAGG - Intronic
1008150028 6:47939030-47939052 TTACAGGGGGAAAATGGGGAAGG + Intronic
1008326296 6:50185943-50185965 TCTAAGAAGGAGAAATGGGATGG - Intergenic
1008728389 6:54450101-54450123 TTCCAAAAGGAGAAGGGAGAAGG + Intergenic
1008828319 6:55726785-55726807 TGGCAGAAGGTGAAAGAGGAAGG + Intergenic
1009395400 6:63193664-63193686 TTCCAGAAGGAGCAAGGAGCAGG + Intergenic
1010071149 6:71747699-71747721 GGAAAGATGGAGAAAGGGGAAGG - Intergenic
1010087233 6:71935297-71935319 TTACAGAATGAGATATGGGGTGG - Intronic
1010439409 6:75875991-75876013 TGACTGAAGGAGAGAAGGGAGGG - Intronic
1010573614 6:77507182-77507204 TTAGGGAAGGAGAAAGTGAAGGG + Intergenic
1011704010 6:89983137-89983159 TTAAAGAAGGAGGCAGAGGATGG - Intronic
1011741017 6:90360716-90360738 TTACAGATGGAGAAATCTGAAGG - Intergenic
1011972720 6:93247625-93247647 TTACAGCAGGAAATAGGGAAAGG + Intronic
1011974187 6:93273333-93273355 TTACAGAATGAGATAGAGCATGG - Intronic
1012380996 6:98619481-98619503 CTACAGATGAAGAAAGGTGAGGG + Intergenic
1012581479 6:100875248-100875270 TTAAAGAAGGAGAAAGGAGCAGG + Intronic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012978894 6:105809485-105809507 CTACAGCAGGAGAAAAGTGAGGG - Intergenic
1014276461 6:119395267-119395289 TTATAGAGGGAGAAAGGGAAGGG + Intergenic
1014372823 6:120633899-120633921 TCACAGAAGCAGAGAGGGAATGG + Intergenic
1014594028 6:123310579-123310601 TTAAAGAAAAAGAAAGGTGAAGG + Intronic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1015214429 6:130733693-130733715 TTACTGAAGGAGTAAGGAAATGG - Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015318669 6:131846557-131846579 TTAAAGAAGGAGAAAGGTTGGGG - Intronic
1015890117 6:137962204-137962226 TCACAGAAGGAAAAATGTGAGGG - Intergenic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1016681792 6:146839026-146839048 TTACTGAAGAAGATATGGGATGG + Intergenic
1016683143 6:146853412-146853434 TTACAGAAACAGAAAGCAGAAGG - Intergenic
1016731850 6:147436038-147436060 TTGCAGAAGGACAAAGAGAAGGG - Intergenic
1016833143 6:148452699-148452721 TTACAGAGGGGGTGAGGGGAGGG - Intronic
1016879918 6:148900965-148900987 TTAAGGAAGGAGAGAGGAGAAGG - Intronic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017539405 6:155385089-155385111 TCACAAGAGGAGAAAGGAGAAGG - Intergenic
1017766713 6:157612745-157612767 TTACTGAAGGAGAGAAGGGAGGG + Intronic
1017775630 6:157678832-157678854 TGAAAGAAGGAGAAACGGGGAGG + Intergenic
1018438486 6:163785621-163785643 ATATAGAAGGGGAAAGGGCATGG + Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019099612 6:169618066-169618088 TCAGAGAAGAAGAAAAGGGAGGG + Intronic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1020489318 7:8759626-8759648 TTACAGAAGCATGAAGGAGATGG + Intergenic
1021148775 7:17123224-17123246 TTTCAGCAGAAAAAAGGGGAAGG + Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021602008 7:22373485-22373507 TTTCAGGAAGAAAAAGGGGAGGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022119787 7:27297140-27297162 TTACAGGAAAACAAAGGGGAGGG - Intergenic
1022478760 7:30729303-30729325 CTACAGGAGGAGGAAGAGGAGGG + Intronic
1022554971 7:31284030-31284052 TTGCGAAAGGAGAAATGGGAGGG - Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022701702 7:32767251-32767273 TTACAGAATGTTAAAGTGGATGG + Intergenic
1022762502 7:33370783-33370805 GTACAGAAACAGAAAGGGGCAGG - Intronic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1022905706 7:34853565-34853587 TTACAGAATGTTAAAGTGGATGG + Intronic
1023013653 7:35944522-35944544 TTACCAAAGGACAAAGAGGAAGG - Intergenic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023218482 7:37892904-37892926 TAAAAGAAAGAGAAAGAGGAAGG - Intronic
1024077477 7:45829312-45829334 TTACCAAAGGACAAAGAGGAAGG + Intergenic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024521633 7:50309465-50309487 TTATAGAAAGAAAGAGGGGAAGG - Intronic
1025126933 7:56352095-56352117 TTACCAAAGGACAAAGAGGAAGG - Intergenic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1026364359 7:69632638-69632660 TTAAGGAAAGAGAAAGGGAAAGG - Intronic
1026792416 7:73342878-73342900 CTACAGCAGGAGAAAGTTGAAGG + Exonic
1027186196 7:75972174-75972196 TTACTGTAGGGGAAATGGGAAGG + Intronic
1027491670 7:78834872-78834894 TGAAAGCAGGAGCAAGGGGAGGG - Intronic
1027625579 7:80540637-80540659 TTACAGAAGAAGAAAGTCAATGG - Intronic
1027933768 7:84575643-84575665 TTACAGAAGGTGGAAGGGCAGGG + Intergenic
1028002748 7:85521247-85521269 TTACACTAAGAGAAAGGGGAAGG + Intergenic
1028045755 7:86117018-86117040 GATCAGAAAGAGAAAGGGGATGG + Intergenic
1028895242 7:96033717-96033739 GTACATAAGGAGACAGGGCACGG + Intronic
1029180491 7:98697897-98697919 TTAGGGAAGGAGAAAGGAGCTGG - Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029572362 7:101378747-101378769 TTCCAGAACAAGAAAGGGGGTGG - Intronic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029612540 7:101634902-101634924 TGACAGGAGGAGAAAGGGGTAGG + Intergenic
1030299164 7:107957901-107957923 TTTGAGAATGAGAAAGGGTATGG - Intronic
1030780069 7:113589749-113589771 TCACAGAAAGATAATGGGGAGGG - Intergenic
1031323450 7:120362941-120362963 GTATAGCTGGAGAAAGGGGAAGG + Intronic
1031533871 7:122910185-122910207 TTAGAAAGGGAGAAAGGGGCTGG + Intergenic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1033000831 7:137502541-137502563 GGAGAGGAGGAGAAAGGGGAAGG + Intronic
1033350675 7:140559406-140559428 TTTCAGGATGAGAACGGGGAAGG + Intronic
1034086620 7:148328214-148328236 TTTCAGGTGGAGAGAGGGGAAGG + Intronic
1034552419 7:151830057-151830079 TTCTAGATGGAGAAATGGGATGG + Intronic
1035956662 8:4088087-4088109 CCACAAAAGGAGAAAGAGGAAGG + Intronic
1037099578 8:15027770-15027792 TTAAAGAAAGAGAAGGGAGAGGG + Intronic
1037241831 8:16786151-16786173 TCACAGAGGCAGAAATGGGAGGG + Intergenic
1037281396 8:17246609-17246631 TTAGGGAAGTAGAAAGGGGGCGG - Exonic
1037653745 8:20865445-20865467 AGAAAGAAGGAAAAAGGGGAAGG - Intergenic
1037747644 8:21659680-21659702 CTGCAGAAGGAGACAGGGAAGGG - Intergenic
1038186776 8:25282388-25282410 ATACAGCAGGTGAAAGGAGATGG - Intronic
1038256881 8:25958416-25958438 GTGCAGATGGAGAAAGGGGCAGG - Intronic
1038665588 8:29534752-29534774 TTCCAGAAAAAAAAAGGGGAGGG + Intergenic
1039125766 8:34199909-34199931 TCACATAAGGGGAAAGAGGAAGG - Intergenic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1039825477 8:41170225-41170247 TCCCAGAAGGAGAAAGAGGAAGG + Intergenic
1040502291 8:48015679-48015701 TCACAGAAGTAGACAGGAGATGG - Intronic
1040770548 8:50970129-50970151 CCACAGAATGAGAAGGGGGAAGG + Intergenic
1041485188 8:58368854-58368876 TTACAGAAGGAGGAATGGTAGGG + Intergenic
1042387726 8:68197091-68197113 TTACAGAAGAGCAAAAGGGAGGG + Intronic
1042601726 8:70505622-70505644 ATAAAGAGGGAGGAAGGGGAAGG - Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043209640 8:77495117-77495139 TTATAGTAGGAGGAAGTGGATGG - Intergenic
1043298057 8:78691605-78691627 TTACAAAAGGAGAAAACAGATGG - Intronic
1044622937 8:94208419-94208441 TTCCAGAAGGACAAAGTAGATGG - Intronic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045089537 8:98726841-98726863 TGACAGAAGGAAAAAAGAGATGG + Intronic
1045135488 8:99212272-99212294 GTATAGAAGGAGAGAGGTGAAGG - Intronic
1045299619 8:100899913-100899935 AGACAAAAGGAGAAATGGGAAGG + Intergenic
1046160483 8:110356699-110356721 TAACATAAGGATAAAGGCGAAGG - Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1046949639 8:120007555-120007577 TGACAGAAGGAGACACAGGAAGG - Intronic
1047338789 8:123960173-123960195 TCAAAGAACGAGAAAGTGGAAGG + Intronic
1047647757 8:126886709-126886731 TCACAGAAGGAGAAAGAGAGAGG - Intergenic
1047701389 8:127452689-127452711 GAAAAGCAGGAGAAAGGGGAAGG + Intergenic
1047857752 8:128930946-128930968 TTCCAGAAGCAGACAGGGAAAGG - Intergenic
1047991234 8:130288781-130288803 TTATAGAAGGAAAGAAGGGAGGG + Intronic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048225994 8:132586125-132586147 TTAGAGAAGGAGAGAGAGAACGG + Intronic
1048283316 8:133121354-133121376 TGACATAGGGAGAAAGGGGCTGG - Intronic
1048590669 8:135818089-135818111 TAACAGGAGGAGCAAGGAGAGGG + Intergenic
1049193038 8:141299274-141299296 CTACGGAAGGAGAAAGCGGACGG + Intronic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049506057 8:142999284-142999306 TAACAGCAGGAAAAAAGGGAGGG - Intergenic
1049644129 8:143728490-143728512 TTAGGGAAGGAGAAGGGGGTTGG + Exonic
1050224927 9:3442648-3442670 TCACAAAAGGAGAAAAGGAATGG + Intronic
1050431758 9:5569322-5569344 GGTCTGAAGGAGAAAGGGGAGGG + Intronic
1050858690 9:10396000-10396022 AGACAGAAGGAGAAAGGGAGAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1052125420 9:24768746-24768768 TGACAGAAGGAGAAAGGAGCTGG + Intergenic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1053131227 9:35616934-35616956 TATCAGACGGAGAGAGGGGAAGG + Intronic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053416406 9:37949590-37949612 GGACAGAAGCAGCAAGGGGAAGG + Intronic
1054799378 9:69331998-69332020 TCACAGACGGGGAAAGGGGTTGG - Intronic
1054866953 9:70012734-70012756 TCAGAGAAGGAGAAAGGGGGAGG - Intergenic
1055048777 9:71958714-71958736 GGAAAGAAAGAGAAAGGGGAGGG - Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055410318 9:76021935-76021957 TCAAAGAAAGAGAAAGAGGATGG - Intronic
1055919910 9:81449382-81449404 TAAAAGAAGCAAAAAGGGGAAGG - Intergenic
1056100133 9:83293162-83293184 TTACAAAAGGAAGGAGGGGAGGG + Intronic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056479064 9:86982512-86982534 TTGAAGATCGAGAAAGGGGAAGG + Intergenic
1057590116 9:96365431-96365453 TGGCAGAGGGAGAAAGGGAATGG + Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058752154 9:108050226-108050248 TTACTGAAGGGGAAAGAGGAAGG + Intergenic
1058782442 9:108351889-108351911 ATACAGAAGGAGATAGGTGAGGG - Intergenic
1059599890 9:115765578-115765600 TTACAGAAAAAGAAAGAGGATGG - Intergenic
1059603360 9:115805934-115805956 TTCCAGAAGGGGGAAGGGAAGGG + Intergenic
1059625709 9:116063008-116063030 TTAAAGAAGGAGAAAAGTGAAGG - Intergenic
1059985657 9:119818053-119818075 TTGCAGAGGCTGAAAGGGGATGG - Intergenic
1060057412 9:120426659-120426681 TCAGAAAAGGAGAAAGGGAAGGG + Intronic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060341871 9:122784654-122784676 TTACAGATGGAGAAATGGAGAGG + Intergenic
1060679561 9:125549656-125549678 ATACACAAGGAGAAGGCGGAGGG - Intronic
1060788931 9:126472488-126472510 TTAAAGGAGGAAAAAGGGGGTGG - Intronic
1061528934 9:131194627-131194649 GTACAAAAGGAGAGAGGAGATGG + Intronic
1061615360 9:131775477-131775499 TAACAGAAGGAGGAAGTGGCAGG - Intergenic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1186285860 X:8043515-8043537 TGAAATAAGGAGGAAGGGGAGGG + Intergenic
1186663318 X:11691919-11691941 TTCCAGAAGGAAAAACTGGAAGG - Intergenic
1187082096 X:16001421-16001443 TCTCTGAAGGAGAAGGGGGATGG - Intergenic
1187095752 X:16146273-16146295 TAACTCAAGGAAAAAGGGGATGG + Intronic
1187243085 X:17531143-17531165 CTCCAAAAGGAGGAAGGGGAAGG - Intronic
1187298517 X:18026175-18026197 TTTCAGAAAGAGAAGGGGTAGGG - Intergenic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187588656 X:20691601-20691623 TGACAGAAAGAGAAAGAGCATGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188402709 X:29766630-29766652 ATATATAATGAGAAAGGGGATGG - Intronic
1189052091 X:37656471-37656493 TTACAGATAGATAAAGGGGTTGG - Intronic
1189280717 X:39818703-39818725 TTTAAGAAGGATAAAGGGGGGGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189778436 X:44491059-44491081 TTGCAGGAAGAGAAGGGGGATGG - Intergenic
1190072738 X:47292456-47292478 TTACAGGTGGAGAAGGAGGAGGG + Intergenic
1190299081 X:49045741-49045763 TTACAAAAGAAGAAAGAGGAGGG + Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1192748813 X:73966415-73966437 TTACAGCAGGAGGAAGAGGCAGG - Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193620744 X:83750382-83750404 TGATAGAAGGAGGAAGGGCAGGG - Intergenic
1194913567 X:99676859-99676881 TTACAGAAGGAAGAAAGTGAAGG - Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1195942115 X:110175303-110175325 TTACAAAAGGAGAAGTTGGAAGG + Exonic
1196107751 X:111914511-111914533 ATACAGTAGGAGAAAGGTGGAGG + Intronic
1196849614 X:119925231-119925253 TTACAGAAAGACCAAAGGGAAGG - Exonic
1197063450 X:122211171-122211193 TTCCAGAGGGAGAAAGTAGAGGG - Intergenic
1197169244 X:123412730-123412752 TTACAGATGGAAAAAGGCAAGGG - Intronic
1197260474 X:124312064-124312086 GTAAAGAGGAAGAAAGGGGATGG + Intronic
1198938274 X:141922989-141923011 TGAGGAAAGGAGAAAGGGGAGGG - Intergenic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201283523 Y:12360569-12360591 TTATAGACAGACAAAGGGGAGGG + Intergenic
1201439312 Y:13991444-13991466 CTACAGGAGGAGAAAGACGACGG + Intergenic
1201445261 Y:14051264-14051286 CTACAGGAGGAGAAAGACGACGG - Intergenic
1202062821 Y:20905262-20905284 TTACAGAAAGATAACGGGCAGGG - Intergenic