ID: 1044890763

View in Genome Browser
Species Human (GRCh38)
Location 8:96832926-96832948
Sequence CGGTGTGCCAGCCTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044890763_1044890772 -3 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890772 8:96832946-96832968 CCGGTGGTATGGGAGGGCCAGGG No data
1044890763_1044890775 28 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890775 8:96832977-96832999 CCTGTAATAGTTCAAAAGAGAGG No data
1044890763_1044890770 -4 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890770 8:96832945-96832967 ACCGGTGGTATGGGAGGGCCAGG No data
1044890763_1044890768 -10 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890768 8:96832939-96832961 TGGCACACCGGTGGTATGGGAGG No data
1044890763_1044890769 -9 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890769 8:96832940-96832962 GGCACACCGGTGGTATGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044890763 Original CRISPR CGGTGTGCCAGCCTCCAGCC TGG (reversed) Intronic
900183176 1:1321289-1321311 TGGGCTGCCAGCCTCCACCCTGG - Intronic
900977183 1:6025255-6025277 GGGGGTGCCAGCCTCCCTCCTGG + Intronic
901494283 1:9612538-9612560 TGCTGGGCCACCCTCCAGCCTGG - Intronic
901605563 1:10456291-10456313 CTGTTTGAGAGCCTCCAGCCAGG - Intergenic
902756203 1:18550773-18550795 CGGTGTGCCAGGCACCAGCTGGG + Intergenic
903654900 1:24943107-24943129 CGGTGTTCCAGCCACCAGGCGGG + Intronic
903655657 1:24947585-24947607 GGGTGGGCCAGCCTCCATCTGGG - Intronic
904106782 1:28091267-28091289 CAGTGTGCCAGGCTCCATTCTGG - Intergenic
904440777 1:30528140-30528162 CTGTGTGCCAGCCTGGGGCCAGG + Intergenic
904841104 1:33372473-33372495 CTGTGTGGCAGCTACCAGCCTGG - Intronic
904956630 1:34289796-34289818 CATTGTGCCAGTCCCCAGCCTGG - Intergenic
905767405 1:40612744-40612766 CTGTGTGCCAGCTGCCAGCATGG + Intergenic
906186115 1:43863323-43863345 CTGTGTGACTGCCTTCAGCCTGG - Intronic
906707666 1:47906644-47906666 CCGGCTGACAGCCTCCAGCCAGG - Intronic
906724392 1:48033394-48033416 CTCTGTGCCAGCCCCCAGCTGGG - Intergenic
907342669 1:53748003-53748025 TGGTCTCCCTGCCTCCAGCCTGG + Intergenic
910866369 1:91791851-91791873 CTGTGGGCCAGCCACCTGCCAGG - Intronic
911351685 1:96762532-96762554 CGGGGGGTCAGCCCCCAGCCCGG - Intronic
912447741 1:109750669-109750691 CCTTCTGACAGCCTCCAGCCGGG + Exonic
915103161 1:153515159-153515181 AGGTGTGCCGGCCTCCAGGCAGG + Intergenic
916860107 1:168794439-168794461 CTGTGTGCCAGCATCCTGCCAGG - Intergenic
918711922 1:187741762-187741784 CAGTGAGCCATGCTCCAGCCTGG + Intergenic
920204902 1:204284231-204284253 TGCTGTGCTACCCTCCAGCCAGG - Intronic
920746585 1:208634827-208634849 CAATGTCCCAGCTTCCAGCCAGG - Intergenic
1062926419 10:1318865-1318887 GGGTCTGCCAGCCTCCAGACAGG + Intronic
1063442770 10:6086483-6086505 CTGCCTGCCAGCCTCCTGCCAGG + Intergenic
1063660792 10:8034263-8034285 CTGTGTGCCACCCGCAAGCCAGG - Intergenic
1064247975 10:13684427-13684449 GGGTTTCCCAGCTTCCAGCCGGG + Intronic
1065149407 10:22806728-22806750 TGGTGTCCCATCCTCCAGCCTGG + Intergenic
1066553022 10:36580520-36580542 CTGGGTGGCACCCTCCAGCCAGG - Intergenic
1067151409 10:43738002-43738024 CTGTCTGCCTGCCTCCACCCTGG - Intergenic
1067794144 10:49308448-49308470 AGGGGTGTCAGCCTGCAGCCTGG - Intronic
1068888539 10:62124353-62124375 CAGTGTCCCAGACCCCAGCCAGG - Intergenic
1069426476 10:68292916-68292938 CAGTGAGCCAGTCCCCAGCCTGG - Intronic
1069664618 10:70146240-70146262 CAGTGCGCGAGCCTCGAGCCCGG - Exonic
1069956915 10:72057578-72057600 CCCGGTGCCAGCCTGCAGCCAGG - Intergenic
1070798970 10:79233837-79233859 CTGGGTGCCAGCCTGCAGCTAGG - Intronic
1070805214 10:79266819-79266841 CAGAGCCCCAGCCTCCAGCCGGG + Intronic
1072180473 10:92975742-92975764 CGGGGGGCCAGCCCCCCGCCGGG + Intronic
1073491671 10:103856441-103856463 CGGTGAGCTGGCCTCCAACCGGG - Intergenic
1073724382 10:106212676-106212698 CTGCTTTCCAGCCTCCAGCCTGG + Intergenic
1074452608 10:113571455-113571477 CGGTGTGCCAGCTCAGAGCCTGG - Intronic
1074886778 10:117700143-117700165 CTGTGTGCGTGCCTCGAGCCTGG - Intergenic
1075545987 10:123355087-123355109 CTGTGTGCCAGGCACCAGCTAGG + Intergenic
1075564578 10:123494237-123494259 CTGTGTGCCAGGCTCCATGCTGG + Intergenic
1075746609 10:124732391-124732413 GGGTCTGCCAGCTTCCTGCCTGG - Intronic
1075967761 10:126627487-126627509 TGGGGTTCCTGCCTCCAGCCTGG + Intronic
1076306131 10:129466965-129466987 CGGCGTGCCGGCGTCCAGCGAGG + Intergenic
1076839620 10:133039586-133039608 CGGTGTTCCAGCGTCCACACGGG - Intergenic
1077026345 11:441675-441697 CGGCGTTCCTCCCTCCAGCCCGG - Intronic
1077038521 11:507076-507098 CGGTGCGTCAGCGTCTAGCCAGG - Intronic
1077364750 11:2157051-2157073 CGGTGTGGCTGCCTCCAGGCTGG - Intronic
1077480227 11:2811143-2811165 GGGTGTGACAGGCTCCAGACAGG - Intronic
1078338046 11:10478945-10478967 CAGTGTGCCAGCCTGCACCCCGG - Intronic
1078577829 11:12516591-12516613 CGGGCTGCAAGCCTCCTGCCAGG + Intronic
1078669553 11:13352882-13352904 CAGGGTGCCTGCCTACAGCCAGG - Intronic
1082242723 11:49889053-49889075 GCGTGAGCCGGCCTCCAGCCAGG - Intergenic
1083290127 11:61685165-61685187 AGGTGTGCCAGCATCCAATCTGG - Intronic
1083624728 11:64066591-64066613 CTGCATTCCAGCCTCCAGCCTGG + Intronic
1083630492 11:64092642-64092664 CTGTGTGCCAGCCACCAGCTGGG + Intronic
1083769572 11:64858962-64858984 CAGGGTGCCAGCCTGCAGCCCGG - Intronic
1083770466 11:64864206-64864228 CGGGGTCCTGGCCTCCAGCCTGG + Intronic
1084411994 11:69010785-69010807 AGGTGGACCAGCCTCCAGCAGGG - Intronic
1084554679 11:69868698-69868720 CGCTATGCCAGCCCCCAGCCCGG + Intergenic
1084944909 11:72633202-72633224 CTGTGTCCAAGCCACCAGCCAGG + Intronic
1086964508 11:93013811-93013833 CAGTCTGCCTGCCTCCAGACTGG + Intergenic
1089447387 11:118564384-118564406 CTGTGTGCCAGCCTTATGCCTGG - Intronic
1089686023 11:120147296-120147318 GGGTGTGGCAGCTTCCAGCAGGG + Intronic
1089782722 11:120884818-120884840 CTGTGAGCCAGCTTCCAGCTAGG + Intronic
1091840918 12:3619945-3619967 TGTGGTGCCAGCCTCCAGCAAGG - Intronic
1096400061 12:51298493-51298515 CAGTGAGCCACACTCCAGCCTGG + Intronic
1096576154 12:52554113-52554135 AGGAGTGCAAGCCTCCAGGCAGG + Intergenic
1096809099 12:54158468-54158490 CTGTTTGCCTGCCTCCAGCCAGG + Intergenic
1098347711 12:69524020-69524042 CGGGGTGCCAGCCTCCATGCAGG + Intronic
1099065312 12:77969784-77969806 CGGTGAGCCAAGATCCAGCCTGG + Intronic
1101036885 12:100715984-100716006 CGGTCAGCCAGCCAGCAGCCGGG - Intergenic
1101750417 12:107578933-107578955 CAGTGTGCCAGGCACCATCCTGG + Intronic
1101901163 12:108792252-108792274 GGGTGTGCCACCCTGCAGGCCGG + Intronic
1103343866 12:120236353-120236375 CTGTATTCCACCCTCCAGCCTGG - Intronic
1103763654 12:123267783-123267805 CAGCGTGCCTGTCTCCAGCCAGG - Intronic
1106478085 13:30114997-30115019 CGGGGTGCCGGCCTGCAGCCAGG - Intergenic
1106852271 13:33807003-33807025 CAGTGTGCCAGCATCCTGCTTGG + Intergenic
1112084550 13:96016654-96016676 CTGTGTGGCAGGCTCCTGCCTGG - Intronic
1112545219 13:100361705-100361727 CGGTTTCCCAGCCTCTAGCCTGG + Intronic
1114522142 14:23346610-23346632 GTGTGGGCCAGCCTCCCGCCAGG + Exonic
1115603607 14:34979037-34979059 CGGCACACCAGCCTCCAGCCTGG + Intergenic
1116986445 14:51224753-51224775 CTGTGTGCCAGCTTCCAGGAAGG + Intergenic
1119028127 14:71169836-71169858 CTTTGTACCAGCCACCAGCCAGG - Intergenic
1119082543 14:71709415-71709437 CGATGTGGCAGCCCCCAGCGAGG - Exonic
1119474676 14:74920235-74920257 GGGTGTGACAGCCGCCAGCAAGG - Intronic
1121321228 14:92992768-92992790 GGCTGGGCCAGCATCCAGCCAGG - Intronic
1121338337 14:93090521-93090543 TGGTGTGCTAGCCACCATCCTGG + Intronic
1122672672 14:103384610-103384632 CTGGGTGCCAGCCTCGGGCCAGG - Intergenic
1122771745 14:104100800-104100822 CCGAGTGCCAGCATCCAGCATGG - Intronic
1122783589 14:104153897-104153919 TGGTGTGCCATCCACCAGCAGGG - Intronic
1123039317 14:105483913-105483935 GGGTGCGGCAGCCTGCAGCCAGG - Intergenic
1123994331 15:25707836-25707858 GGCTGTGCCAGCGTCCTGCCAGG + Intronic
1124635754 15:31364340-31364362 CACTGTGGCAGTCTCCAGCCAGG + Intronic
1125236416 15:37519166-37519188 CAGTAAGCTAGCCTCCAGCCTGG + Intergenic
1127736172 15:61840948-61840970 AGGAGTTCCAGCCTGCAGCCTGG - Intergenic
1127870575 15:63069489-63069511 CGCTGGGCTCGCCTCCAGCCAGG + Intronic
1128061138 15:64736697-64736719 CTCTGTGCCAGCCTCCACCCAGG - Intergenic
1128067939 15:64775789-64775811 CGGGGCGCCGGCCTCCGGCCGGG + Intergenic
1128970390 15:72101338-72101360 CGGGGCGTCAGCCTCCCGCCCGG + Intronic
1129912388 15:79239489-79239511 TGGTGCTCCAGACTCCAGCCTGG - Intergenic
1131138679 15:89959445-89959467 CTGCATGCCAGCCTGCAGCCTGG - Intergenic
1132469360 16:93353-93375 CGGTGGGCCAGCCTCAGGCATGG - Intronic
1132872785 16:2123168-2123190 CTGCGTGCCAGGCTCCAGGCTGG + Intronic
1134522629 16:14925561-14925583 CGGTTTGCCACCTTCCAACCTGG - Intronic
1134550000 16:15134495-15134517 CGGTTTGCCACCTTCCAACCTGG + Intronic
1134551873 16:15142347-15142369 CTGCGTGCCAGGCTCCAGGCTGG + Intergenic
1134710299 16:16324212-16324234 CGGTTTGCCACCTTCCAACCTGG - Intergenic
1134718470 16:16368500-16368522 CGGTTTGCCACCTTCCAACCTGG - Intergenic
1134949305 16:18344433-18344455 CGGTTTGCCACCTTCCAACCTGG + Intergenic
1134956283 16:18383659-18383681 CGGTTTGCCACCTTCCAACCTGG + Intergenic
1136425855 16:30169149-30169171 CGGGGCGTCAGCCTCCCGCCTGG + Intergenic
1136543341 16:30941420-30941442 CGGTGAGCCTGAGTCCAGCCTGG + Intronic
1136551256 16:30983771-30983793 CGGTGCGCCAGGGGCCAGCCGGG + Exonic
1138467122 16:57200777-57200799 GGGGGGGCCAGCCCCCAGCCCGG - Intronic
1139371923 16:66474334-66474356 CTGCCTGCCAGCCACCAGCCTGG + Intronic
1139386797 16:66578247-66578269 TGGTCTTCCTGCCTCCAGCCTGG + Intronic
1139423261 16:66862293-66862315 CGGGGTGCCAGGCTCAAGGCAGG - Intronic
1139576842 16:67847224-67847246 CGGTGCACCAGCCACCAGCACGG - Intronic
1139588115 16:67917242-67917264 AGATGTGCCACCCTCCAGTCGGG - Intronic
1140687879 16:77450987-77451009 CACTGTGCCAGCCTGGAGCCAGG - Intergenic
1141067720 16:80927439-80927461 TGGTGACCCAGGCTCCAGCCAGG - Intergenic
1141833144 16:86520919-86520941 TGGTGTGCCTGGCTCCAGCACGG + Intergenic
1142029301 16:87830600-87830622 CTGTGTGCCCCACTCCAGCCTGG - Exonic
1142412062 16:89921901-89921923 CGGTGAGTCAGCCTTAAGCCCGG + Intronic
1143431940 17:6894154-6894176 CGGGGCGCCAGCCTCCCCCCGGG - Intronic
1143496885 17:7317543-7317565 TAGTGTCCCAGCCTCCAGGCGGG + Exonic
1144631441 17:16874500-16874522 GGGTGTGACAGCCCCCAACCTGG + Intergenic
1144716910 17:17442404-17442426 CGGGGCGTCAGCCTCCCGCCCGG - Intergenic
1144717129 17:17442878-17442900 CGGGGCGTCAGCCTCCCGCCCGG - Intergenic
1144717276 17:17443204-17443226 CGGGGCGTCAGCCTCCAGCCCGG - Intergenic
1145927927 17:28661813-28661835 CGCTGTGGGAGCGTCCAGCCTGG - Exonic
1147405670 17:40210190-40210212 TGGTGTTCCGGCCTCCAACCTGG + Intergenic
1148194622 17:45704436-45704458 CTGTGTGCCAGCCTCCTCCTGGG - Intergenic
1148576475 17:48715145-48715167 CAGTGAGCCACACTCCAGCCTGG + Intergenic
1148835091 17:50461712-50461734 CCCTGTGCCAGGCCCCAGCCGGG - Intronic
1151404446 17:73877663-73877685 CTGTGTGCCTCACTCCAGCCCGG + Intergenic
1151542613 17:74772308-74772330 CCGTGTGCCAGGCTCCAGTGCGG + Intronic
1152657737 17:81527800-81527822 CTGTGTTCCACCCTCCAGCGTGG + Intergenic
1156404711 18:36773069-36773091 CAGTGTCCTGGCCTCCAGCCTGG - Intronic
1157569521 18:48703348-48703370 CGGTGTGGCCACCTCCTGCCTGG + Intronic
1157579311 18:48764256-48764278 TAGTGTGCCAGGCACCAGCCTGG + Intronic
1158608782 18:58919802-58919824 CGTGGTGCCGGCATCCAGCCTGG + Exonic
1158698435 18:59724355-59724377 CAGTGTGCCAGTCTGAAGCCTGG + Intergenic
1160679480 19:406238-406260 CGGGGTGGCAGCCCCCAGCGAGG + Exonic
1160698464 19:495576-495598 CGGGCTCCCAGGCTCCAGCCAGG + Intronic
1160760615 19:782376-782398 GGATGTCCAAGCCTCCAGCCAGG - Intergenic
1161119661 19:2518326-2518348 GTGGGTGCCAGCCCCCAGCCCGG - Intronic
1161474635 19:4477468-4477490 CGCTGTGCCTGTCCCCAGCCTGG + Intronic
1161664278 19:5565476-5565498 CTGTGTGCCAGACTCCATGCTGG - Intergenic
1162241151 19:9355407-9355429 CTGTGCTCCAGCCTCCAGCCTGG + Intronic
1162301512 19:9847600-9847622 CGGGGGGCCAGCCCCCTGCCTGG + Intronic
1162474435 19:10891526-10891548 CTGTCCGCCAGCCTCCAGCTGGG + Intronic
1163557087 19:17999000-17999022 CTGTGTGCCAGGCCCCAGCGGGG + Exonic
1163785465 19:19272898-19272920 CCGCATCCCAGCCTCCAGCCCGG + Intronic
1165106716 19:33474476-33474498 AGATGTGCCAGGCTGCAGCCTGG + Intronic
1166640255 19:44489103-44489125 GGGGGGGCCAGCCTCCCGCCCGG + Intronic
1166657365 19:44622160-44622182 CAGTGAGCCAAGCTCCAGCCTGG + Intronic
1167879472 19:52444292-52444314 AGGTCTGCCAGGCTCCAGGCTGG + Intronic
1168117436 19:54231794-54231816 CTGAGCGCCAGCATCCAGCCCGG + Intronic
1168297461 19:55384342-55384364 AGGTGTGCCAAGCTCCCGCCTGG + Exonic
925274438 2:2638677-2638699 CCCTGTGCCCGCCTCCTGCCTGG - Intergenic
926801447 2:16664290-16664312 AGTTCTGCCAGCCCCCAGCCTGG + Intronic
927315448 2:21676041-21676063 CTGTTGGCCAGCCTCCACCCAGG - Intergenic
927572984 2:24175757-24175779 CGGTGCGCCAGCCCCCAGGCTGG - Exonic
928389359 2:30897382-30897404 AGATGTGCCAGAGTCCAGCCTGG - Intergenic
928740993 2:34352279-34352301 CGCCCTGCCACCCTCCAGCCTGG - Intergenic
929789726 2:45013897-45013919 CTCTGTGCCGGCCTCCAGGCTGG - Intergenic
930785115 2:55264266-55264288 CTGCATTCCAGCCTCCAGCCTGG - Intronic
933773505 2:85758405-85758427 CAGTTTGCCAGCCTCCAGGGTGG + Intronic
933842930 2:86302173-86302195 CCGGGTCCCAGACTCCAGCCTGG + Intronic
933978522 2:87531137-87531159 GGCTGTGTCAGCCTCCTGCCTGG - Intergenic
934775083 2:96932239-96932261 CACTCTGCCAGCCTCCAGCTGGG + Intronic
935625213 2:105166747-105166769 TGCTGTGCCAGCCTCTCGCCAGG - Intergenic
936315310 2:111419665-111419687 GGCTGTGTCAGCCTCCTGCCTGG + Intergenic
936739770 2:115491079-115491101 CTGTACTCCAGCCTCCAGCCTGG + Intronic
937033682 2:118763089-118763111 CCGTGTGCCAGCCAGCAGCCAGG - Intergenic
937258544 2:120571205-120571227 CTGAGTGCCAGCATCCTGCCAGG - Intergenic
937262667 2:120596408-120596430 CGCTGTGCCACACTCGAGCCAGG + Intergenic
937316851 2:120937183-120937205 ATGTGTGCCAGCCTCATGCCAGG + Intronic
937722990 2:125125840-125125862 AGGTCTGCCAGGCTCCAGGCTGG + Intergenic
945593144 2:211759297-211759319 CGGTGTCCTAGCTTCCACCCTGG + Intronic
945930155 2:215846765-215846787 CTGTACTCCAGCCTCCAGCCTGG - Intergenic
947119223 2:226799079-226799101 CCCTGTGCCGGACTCCAGCCGGG - Exonic
948030133 2:234810729-234810751 CGATGTGCCCTTCTCCAGCCGGG + Intergenic
948396813 2:237650641-237650663 CACTGTGCCAACGTCCAGCCTGG - Intronic
948795582 2:240400626-240400648 TGATGTGCCATCCTCCATCCTGG - Intergenic
1168934175 20:1648574-1648596 CTGTGTGCCAGACTCCGCCCTGG - Intronic
1170879763 20:20286287-20286309 AGGTGGTCCAGCCTCCAGCCAGG + Intronic
1171544776 20:25991571-25991593 CGAGATGCCAGCCTCAAGCCAGG + Intergenic
1172096503 20:32463175-32463197 CGGGGTGCAGGCCTCCAGCTGGG + Intronic
1173054586 20:39598783-39598805 CTGGTTGCCATCCTCCAGCCAGG + Intergenic
1173925715 20:46779800-46779822 CGATGTGCCAACCTCCATGCTGG - Intergenic
1175361298 20:58414115-58414137 CGGGGCGTCAGCCTCCCGCCCGG - Intronic
1175466707 20:59194389-59194411 CCGTGTTCCCCCCTCCAGCCTGG + Exonic
1175802324 20:61807893-61807915 CGCTGTGCCTGCATCCCGCCAGG - Intronic
1175914451 20:62419224-62419246 CCGTGGGCCGGCCTCCAGCGTGG - Intronic
1175981030 20:62738711-62738733 CGTGTTCCCAGCCTCCAGCCCGG - Intronic
1176057253 20:63155308-63155330 TGCCCTGCCAGCCTCCAGCCTGG - Intergenic
1179461483 21:41538354-41538376 CTGTGTTCCTGCCCCCAGCCCGG - Intergenic
1180115774 21:45704053-45704075 CAGAGGGCCAGCCTCCATCCTGG - Intronic
1180205189 21:46255457-46255479 CTGTCTGCCAGCTTCCACCCTGG - Intronic
1180618257 22:17143006-17143028 CAGTGTGACTGCCTGCAGCCTGG - Intronic
1180840725 22:18957712-18957734 TGGTGTGGCAGCCTCCACCACGG + Intergenic
1181762683 22:25068843-25068865 CAGTGTGCCAAGCTCCAGCCTGG + Intronic
1182503083 22:30762769-30762791 CTCTGAGCCAGCCTCCTGCCTGG + Intronic
1184300180 22:43554046-43554068 AGGAGCGCCAGCCTCCTGCCAGG + Intronic
1184335063 22:43848125-43848147 CTATGTGCCAGGCTCCAGGCTGG + Intronic
1184436933 22:44484836-44484858 CGGTGTGACCACCACCAGCCAGG - Intergenic
1184693984 22:46129792-46129814 CCCAGTGCCAGCCTCCTGCCTGG + Intergenic
1184930538 22:47677854-47677876 GGGTCAGCCAGCCTCCAGCCAGG - Intergenic
1185065250 22:48628842-48628864 ACGTGTGCCAGCCTCCTGCAAGG + Intronic
1185325345 22:50222803-50222825 TGGTGAGTCAGCGTCCAGCCAGG + Intronic
1185341688 22:50293846-50293868 GGGTGTGCCAGCCCCCGGCAGGG - Intronic
950087276 3:10269129-10269151 AGGTGTGCCAGTTTACAGCCTGG - Intronic
950505913 3:13394404-13394426 CAGAGTGCCCGCCTCCAGACAGG - Intronic
950576799 3:13837012-13837034 CAGTGTGCTGGGCTCCAGCCAGG - Intronic
952642619 3:35615218-35615240 CTGTACTCCAGCCTCCAGCCTGG + Intergenic
953027577 3:39153723-39153745 CGCTGCGCCAGGCTCCAGGCGGG - Intronic
953885967 3:46714543-46714565 CCCTGCCCCAGCCTCCAGCCTGG + Intronic
954683614 3:52358952-52358974 CTGGGTGCCAGGCTCCAGGCTGG + Intronic
954686778 3:52375289-52375311 CGGTGTTCCTGCCTCCACCCGGG - Exonic
954930974 3:54281026-54281048 CAGTGTGCCAGCCTCTAGGGTGG - Intronic
957377556 3:79378304-79378326 CTCGGTGCCAGCCTCCAGCATGG + Intronic
961486570 3:127221417-127221439 TGGGATGCCAGACTCCAGCCAGG - Intergenic
961612154 3:128148551-128148573 CTGTGTGTGAGCCTGCAGCCAGG - Intronic
962319822 3:134381451-134381473 CTGGCTGCCAGCCTCCAGGCAGG - Intergenic
962827123 3:139108180-139108202 CGCTGTGAAAGCCTTCAGCCTGG + Intronic
966509848 3:180749548-180749570 CCCTGTTCCAGGCTCCAGCCAGG - Intronic
967807021 3:193723612-193723634 TGGTGTCCCAGCCTCCAGCTGGG - Intergenic
968088434 3:195885175-195885197 CGGAGTGTGGGCCTCCAGCCAGG - Intronic
968201465 3:196759561-196759583 CTGTACTCCAGCCTCCAGCCTGG - Intronic
968667411 4:1828850-1828872 GGGGGTGTCAGCCTCCCGCCCGG - Intronic
968872134 4:3247539-3247561 CTCTGTGCCAGCCCCCAGCACGG + Exonic
969566621 4:7982420-7982442 CGGTGTCCCAGCATCCAGCCCGG - Intronic
972794606 4:42402804-42402826 CCATTTGCCAGCCTCCTGCCTGG + Intergenic
974047308 4:56908465-56908487 CGGCGTCCCAGCCTCCAGTGGGG - Intronic
975666895 4:76741522-76741544 CAGAGTGCCTACCTCCAGCCCGG + Exonic
977888869 4:102283433-102283455 CTGTTTGCCAGTCTCCATCCTGG + Intronic
981184208 4:141781862-141781884 CTGTACTCCAGCCTCCAGCCTGG + Intergenic
985484422 5:140589-140611 AGGTGTGGCAGGCTGCAGCCTGG - Exonic
985672583 5:1213978-1214000 CTGTGCGCCCGCGTCCAGCCAGG - Exonic
985783354 5:1882093-1882115 CAGGGCCCCAGCCTCCAGCCCGG - Intronic
986529997 5:8726509-8726531 TGGTGGGACAGCCTACAGCCTGG + Intergenic
987137456 5:14913136-14913158 CCCAGTGGCAGCCTCCAGCCAGG + Intergenic
987803744 5:22733970-22733992 AGGTTTCCCATCCTCCAGCCAGG + Intronic
990079885 5:51899735-51899757 CAGTGTTCCACCCTCAAGCCTGG - Intergenic
990798047 5:59566286-59566308 CTCTGTGCCTGCCTCCACCCTGG + Intronic
990918784 5:60939539-60939561 GACTGTGCCACCCTCCAGCCTGG - Intronic
991129268 5:63103516-63103538 CCATATGCCACCCTCCAGCCTGG - Intergenic
991291146 5:65035048-65035070 GGGCGCGCCCGCCTCCAGCCTGG + Intergenic
993986804 5:94607135-94607157 CTATGTGCCAGCCACTAGCCTGG - Intronic
999303454 5:150505186-150505208 AGATGAACCAGCCTCCAGCCCGG - Intronic
999309970 5:150545586-150545608 CTGTGTGCCAGCCCTGAGCCAGG + Intronic
1002125901 5:177043814-177043836 CTGTGTGCCAGACTCCAGCTGGG + Intronic
1002852314 6:1007425-1007447 CTGTGAGCCACCCTCCAGCTGGG - Intergenic
1003722357 6:8718073-8718095 CTGTTCTCCAGCCTCCAGCCTGG - Intergenic
1004427677 6:15517323-15517345 CGGAGTGCCTACATCCAGCCGGG - Intronic
1006263902 6:32900085-32900107 CAGTGTGTCAGCCTCCAAGCGGG + Intergenic
1006623667 6:35384087-35384109 CGGGGCGTCAGCCTCCCGCCCGG + Intronic
1006623758 6:35384309-35384331 CGGGGCGTCAGCCTCCCGCCCGG + Intronic
1007208784 6:40174402-40174424 TGGTGTGCCAGCTCCAAGCCTGG + Intergenic
1008294120 6:49756090-49756112 CGGTGTGGTAGGCTCAAGCCAGG + Intergenic
1015616755 6:135085081-135085103 CAGTGAGCCAAGCTCCAGCCTGG - Intronic
1017495789 6:154982297-154982319 CAATGTGTCACCCTCCAGCCTGG + Intronic
1018672568 6:166192014-166192036 TGGTGTGCCTGCCTCCAGCTAGG - Intergenic
1018810399 6:167294416-167294438 AGCTGTGGCGGCCTCCAGCCTGG + Intronic
1018937454 6:168283150-168283172 TGGACTGCCAGCCTCCCGCCCGG - Intergenic
1019493022 7:1323871-1323893 GGGAGAGCCAGCCTCCAGCGTGG + Intergenic
1019636749 7:2080103-2080125 GGGTGGGCCAGCCTCGAGGCTGG + Intronic
1019981374 7:4624179-4624201 GGGGGTGTCAGCCTCCCGCCAGG + Intergenic
1020005911 7:4783730-4783752 CGCTACGCCAGCCTCCAGCAAGG + Exonic
1021364198 7:19755990-19756012 CTGTACTCCAGCCTCCAGCCTGG + Intronic
1023828607 7:44026154-44026176 CCCAATGCCAGCCTCCAGCCAGG - Intergenic
1027244062 7:76354013-76354035 CAGTGAGCCATGCTCCAGCCTGG + Intronic
1029431920 7:100536844-100536866 CAGGCTGCCAGCCACCAGCCTGG + Intergenic
1029477767 7:100795110-100795132 GGGCGTCCCAGCCCCCAGCCAGG + Intronic
1029580719 7:101435370-101435392 CAGGGTGTCTGCCTCCAGCCAGG - Intronic
1029738902 7:102480434-102480456 CCCAATGCCAGCCTCCAGCCAGG - Intergenic
1029756903 7:102579597-102579619 CCCAATGCCAGCCTCCAGCCAGG - Intronic
1029774842 7:102678657-102678679 CCCAATGCCAGCCTCCAGCCAGG - Intergenic
1031159208 7:118145731-118145753 TTCTGTGGCAGCCTCCAGCCAGG - Intergenic
1031726519 7:125246655-125246677 TCGTGTGACAGACTCCAGCCTGG + Intergenic
1032080063 7:128854276-128854298 CAGTCTGCCAGCATCAAGCCTGG - Intronic
1034164216 7:149013270-149013292 CTGTGTGCCAGGCCCCAGCTGGG - Intronic
1034390451 7:150783137-150783159 CAGTGGGCCATACTCCAGCCTGG + Intergenic
1034412107 7:150947177-150947199 AGGTGTGGCAGCCCCCAGCTGGG + Intronic
1034924023 7:155106564-155106586 CGTGCTGCCAGCATCCAGCCTGG + Intergenic
1035390897 7:158503941-158503963 CAGTGAGCCACACTCCAGCCTGG + Intronic
1037322315 8:17655685-17655707 CTGTACTCCAGCCTCCAGCCTGG + Intronic
1039384100 8:37116617-37116639 CAGTGTGCCAGCCTTCATACTGG + Intergenic
1039476415 8:37841500-37841522 CGGGGTGGCAGCCTCCGCCCTGG + Exonic
1040632373 8:49230372-49230394 CAGTGTTCCTGCCTCCAACCTGG - Intergenic
1044415894 8:91939176-91939198 CGATTTCCCAGCCTCCAGCTAGG - Intergenic
1044780971 8:95743028-95743050 CTGTACTCCAGCCTCCAGCCTGG + Intergenic
1044890763 8:96832926-96832948 CGGTGTGCCAGCCTCCAGCCTGG - Intronic
1046757840 8:117989905-117989927 CACTGTGCCCGCCTCCAGTCTGG - Intronic
1046769530 8:118104393-118104415 AGGTGTGCCAGCCCCCTGCATGG - Intronic
1049417821 8:142503596-142503618 CTGAGTGCCAGCCTCCTGCTGGG + Intronic
1049466010 8:142751617-142751639 GGGTGTGCCAGGCTGCATCCGGG + Intronic
1049719014 8:144107066-144107088 CTGTGTGCCAACCTCCGCCCAGG + Exonic
1050558255 9:6807892-6807914 GGGGGTGTCAGCCCCCAGCCCGG + Intronic
1051276974 9:15406884-15406906 CGGGGCGTCAGCCTCCCGCCCGG + Intergenic
1051546282 9:18279823-18279845 GGGTGGGCCAGCCTGGAGCCTGG + Intergenic
1051724219 9:20072028-20072050 GGGTGTGCCACCCTCCTGGCAGG + Intergenic
1055288998 9:74762794-74762816 GGGGATGCCGGCCTCCAGCCAGG + Exonic
1056936054 9:90915495-90915517 AGGCCTGCTAGCCTCCAGCCTGG + Intergenic
1058149549 9:101449246-101449268 CTGTGTCCCCGCCTCCAACCTGG - Intergenic
1058284043 9:103153598-103153620 AGGAGTGCCAGCCTCAACCCTGG - Intergenic
1059824174 9:118008678-118008700 GGCTGTGACAGCCTCCAGCAAGG + Intergenic
1060487858 9:124060776-124060798 TGGCACGCCAGCCTCCAGCCTGG + Intergenic
1060552735 9:124493168-124493190 CGGGGGGCCGGGCTCCAGCCAGG + Intronic
1060589540 9:124808163-124808185 CGGTGTGCTAGCACCCTGCCAGG + Intronic
1061282966 9:129607979-129608001 CGGACTGCCAGCCTGCAGCCTGG - Intergenic
1061305019 9:129727221-129727243 GGTTGTGCCATACTCCAGCCTGG - Intergenic
1061546647 9:131308423-131308445 GGGTTCGCCAGCCTCCAGCCAGG - Exonic
1061764283 9:132871605-132871627 CTGGGGGCCAGCCTCCAGCCGGG - Intronic
1062319393 9:135983000-135983022 CGTTGGGCCAGCCTACAGCAGGG - Intergenic
1190411557 X:50141448-50141470 CGGTGTGCCAATCTCCGTCCTGG - Intergenic
1192317648 X:70065545-70065567 CCATGCCCCAGCCTCCAGCCTGG - Intergenic
1192471651 X:71404393-71404415 CAGTGTGCCACACTCCAGCCTGG - Intronic
1193819939 X:86148923-86148945 CAGTGTGCAAGCCTCCCACCAGG - Exonic
1198627074 X:138588142-138588164 AGGGGTGCCAGCCTCCATGCAGG + Intergenic