ID: 1044890770

View in Genome Browser
Species Human (GRCh38)
Location 8:96832945-96832967
Sequence ACCGGTGGTATGGGAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044890763_1044890770 -4 Left 1044890763 8:96832926-96832948 CCAGGCTGGAGGCTGGCACACCG 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1044890770 8:96832945-96832967 ACCGGTGGTATGGGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044890770 Original CRISPR ACCGGTGGTATGGGAGGGCC AGG Intronic
No off target data available for this crispr