ID: 1044891618

View in Genome Browser
Species Human (GRCh38)
Location 8:96842144-96842166
Sequence TTTTATTCCCTGAGAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044891618_1044891623 14 Left 1044891618 8:96842144-96842166 CCAGTTATTCTCAGGGAATAAAA 0: 1
1: 1
2: 3
3: 23
4: 309
Right 1044891623 8:96842181-96842203 CACTCCCTTTGTTTTTTAATGGG No data
1044891618_1044891622 13 Left 1044891618 8:96842144-96842166 CCAGTTATTCTCAGGGAATAAAA 0: 1
1: 1
2: 3
3: 23
4: 309
Right 1044891622 8:96842180-96842202 CCACTCCCTTTGTTTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044891618 Original CRISPR TTTTATTCCCTGAGAATAAC TGG (reversed) Intronic
900134707 1:1111218-1111240 TTATTTTCCCTTAGAAGAACTGG + Intronic
901537220 1:9890437-9890459 TTTTCTTCCCAGAGAACAGCTGG + Intronic
902050277 1:13558830-13558852 ATGTATTCCCTGAGGATAAAAGG - Intergenic
903612830 1:24629152-24629174 TTTTTTTCCTAGAGAAAAACTGG - Intergenic
904445014 1:30564306-30564328 TTTTATAGCCTGTGAATATCAGG - Intergenic
905489840 1:38334718-38334740 TTTTGTTCTCTGAGAAGACCAGG - Intergenic
905730266 1:40294253-40294275 GTTTATTACCTGAGAGGAACTGG + Intergenic
906627270 1:47334880-47334902 TTTTATATCCTGAGAAAATCTGG - Intronic
906781963 1:48580605-48580627 TTTAATTTCCTGAGAGTGACTGG + Intronic
908104022 1:60822551-60822573 TCTAATTCCCTGAAAATATCAGG + Intergenic
908216071 1:61953822-61953844 TTTAATCTCCTGAGTATAACTGG + Intronic
909482264 1:76138865-76138887 TTTTTACCCCTGAGAATAAAAGG + Intronic
909503764 1:76364046-76364068 TGTTATTCTCTGATAAAAACTGG + Intronic
910617114 1:89210528-89210550 TTTTATAACCTGTGAATATCAGG - Intergenic
912067920 1:105768645-105768667 TTTTATTGTCTGAAAATAATGGG - Intergenic
913100378 1:115558509-115558531 TTTTATACCCTGAGCATTTCTGG - Intergenic
913226818 1:116707874-116707896 TTTTATTTCCTGTGAATTACTGG - Intergenic
916262302 1:162854614-162854636 TTATATTCCCGGAAAATAATAGG + Exonic
916305516 1:163326018-163326040 TTTTCTTCCTTCAGATTAACAGG + Exonic
916628380 1:166584496-166584518 TTTCATTTCCTGAGTATAAAAGG - Intergenic
917067705 1:171114829-171114851 TTTTCTTCCCTGACAAAAAAAGG + Intronic
917630737 1:176889011-176889033 TATTATTGCCTTTGAATAACAGG + Intronic
919082589 1:192884438-192884460 TATCATTCCATGAGAATATCTGG - Intergenic
919133624 1:193481585-193481607 ATTTATTCCCCGTGAATAAAGGG - Intergenic
919693767 1:200550866-200550888 TTTTGTTCCATGATAATAAATGG - Intergenic
920782549 1:209008349-209008371 TTTCATTCCCTGAGAACAATGGG - Intergenic
922856470 1:228779238-228779260 TTTTCTTCTCTCAGAATCACAGG + Intergenic
924066524 1:240228794-240228816 TTTTTTTCCCTAAAAATAAATGG + Intronic
924744112 1:246816657-246816679 TTTTTTTCCATGGGTATAACTGG - Intergenic
1063582398 10:7320491-7320513 TTTTTTTCCTGGAGAATCACTGG + Intronic
1065830846 10:29612285-29612307 ATATTTTCCCTGAGAATCACTGG - Intronic
1066674961 10:37878088-37878110 TTTTATTCCTTCATAATAATGGG + Intergenic
1067242377 10:44507777-44507799 TGTTCTTCCCAGAGAACAACAGG + Intergenic
1067701678 10:48577687-48577709 ATGTATTCTCTGAGAATAAAAGG - Intronic
1068097495 10:52510335-52510357 TTTTATAACCTGTGAATATCAGG + Intergenic
1068228021 10:54132360-54132382 TTTTATTCCTTTAGAAGAAGGGG - Intronic
1068291885 10:55013761-55013783 TTTTATTTCCTATGGATAACAGG - Intronic
1070484953 10:76921368-76921390 TTTTTTTCCCTGGCATTAACAGG - Intronic
1074725649 10:116306009-116306031 TTTTATTCTCTGTAAATAACAGG - Intergenic
1074780512 10:116798837-116798859 TTTTATTCCAAGACAATAATTGG - Intergenic
1074894429 10:117762710-117762732 TCTTATTATCTCAGAATAACAGG - Intergenic
1075773680 10:124963473-124963495 TTTTATCCCCTGACATTAAAAGG + Intronic
1076034561 10:127188261-127188283 TTTTCATCCATGACAATAACTGG - Intronic
1077925904 11:6682035-6682057 TTTTACTCTCTGAGAAGAACTGG - Exonic
1080065299 11:28003913-28003935 TTTTATACCCTGTGAATATCAGG - Intergenic
1080075088 11:28139365-28139387 TTTTTCTCCCAGGGAATAACCGG + Intronic
1080834877 11:35930919-35930941 TTTTATTATCTGACAATCACAGG + Intergenic
1081227757 11:40545707-40545729 TTTCATTGCCTGACAATAAAGGG + Intronic
1084695158 11:70748610-70748632 TTTTATTTCCTGGCAATATCGGG - Intronic
1085485510 11:76860395-76860417 GTTTATTTCCTGAGAATCACGGG + Intergenic
1090648976 11:128789836-128789858 ATTTACTCCCTAAAAATAACAGG - Intronic
1091605598 12:1948973-1948995 TTAGCTTCCGTGAGAATAACAGG - Intronic
1092983606 12:13822655-13822677 TTTTCCTCCCTGACAATATCAGG + Intronic
1093114073 12:15187933-15187955 ATTTATTTCCTGATAATAAAAGG - Intronic
1093237891 12:16634312-16634334 GTTTAATCCCAGAGAAAAACAGG - Intergenic
1094561758 12:31561068-31561090 TTTAAATCCCTGAACATAACTGG - Intronic
1097406004 12:59191122-59191144 TTTTTTTGCCTGAGCATAATTGG + Intergenic
1098510982 12:71313797-71313819 TGCTATTCCCTGAGGATAAAAGG + Intronic
1098522914 12:71453910-71453932 TATCATTCCCTGAGAATAGTAGG + Intronic
1099254073 12:80294041-80294063 TTTTAGTACCTGAGAATAAAGGG + Intronic
1099870357 12:88340619-88340641 GTGTATCCCCTGAGGATAACGGG + Intergenic
1104722613 12:131053490-131053512 TTTTGTGGCCTGAGAATGACAGG + Intronic
1106119869 13:26851271-26851293 TTCTATTACCTGAAAAAAACAGG + Intergenic
1106725672 13:32482736-32482758 TCTGAATCCCAGAGAATAACAGG + Intronic
1107792283 13:44014673-44014695 GGATATTCCCTGAGTATAACGGG - Intergenic
1108010021 13:45996958-45996980 ATGTATTCCCTGAGGATAAGAGG + Intronic
1108649466 13:52461728-52461750 TATTATACCTTGAGAAGAACTGG - Exonic
1109162311 13:58991042-58991064 TTTATTTCCCTCAGAATAAGGGG - Intergenic
1109422696 13:62134239-62134261 TTTTATACCCTGTGAATTTCAGG - Intergenic
1109744812 13:66611223-66611245 TTTCATTCACAGAGACTAACTGG + Intronic
1109922491 13:69086718-69086740 TTTTTTTCCCTGTGTATAATGGG + Intergenic
1110513251 13:76378582-76378604 TTTTATTTCCTCAAAATAAGAGG - Intergenic
1110553826 13:76836317-76836339 AATTATTCCTTGAGAATTACTGG - Intergenic
1111541673 13:89675732-89675754 TTTTATACCCTGAGAATAACAGG + Intergenic
1112204547 13:97311089-97311111 TTTTATTTCCTCAGTGTAACTGG - Intronic
1113539928 13:111098899-111098921 TTTTATTCTTTGTGAATAACTGG - Intergenic
1114884812 14:26835188-26835210 TTATATTTCCTAAGAATAGCAGG - Intergenic
1120307695 14:82791321-82791343 GTTTATTCCCAGATAATAAAAGG + Intergenic
1120534121 14:85671741-85671763 TTTTTTTTCCTAAAAATAACTGG - Intergenic
1120644154 14:87052342-87052364 TTTTATGAACTCAGAATAACAGG - Intergenic
1120645203 14:87065717-87065739 TTTTTTTCACAGAGAATAATAGG - Intergenic
1120763940 14:88311323-88311345 TCTTTTTTTCTGAGAATAACAGG - Intronic
1120788248 14:88556155-88556177 TTTTTTTCCCTTAGAAACACAGG - Intergenic
1122644100 14:103180295-103180317 TTTTATTTCCTAAGAATGAGGGG - Intergenic
1123798133 15:23794290-23794312 TTTTTTTTCCTGAGAGTAATAGG + Intergenic
1125172703 15:36784359-36784381 TTTTTCTCCCTAGGAATAACTGG - Intronic
1126571307 15:50155112-50155134 TTTTATAGCCTGTGAATATCAGG + Intronic
1126621426 15:50644100-50644122 TTTTCTTCACTGTAAATAACTGG + Intronic
1126831054 15:52605814-52605836 ATATATCCCCTGAGAATAAGAGG - Intronic
1127011530 15:54636045-54636067 TGTGATTCCCTGGCAATAACTGG - Intergenic
1127484180 15:59404218-59404240 TTTTTTGCCCTGAGAATCAATGG - Intronic
1127671765 15:61201488-61201510 TTTCATTCCCTGACAGTAATTGG + Intronic
1129456716 15:75680017-75680039 TTTTCTTCTCAGAGAAAAACAGG + Intronic
1129514269 15:76147431-76147453 TTTTCCTCCCTGAGAAAAAAAGG - Intronic
1130757155 15:86776708-86776730 TTTTATTCTCTGTGAATCAATGG + Intronic
1131192263 15:90326051-90326073 TCCTTTTCCCTTAGAATAACTGG - Intergenic
1131543072 15:93290717-93290739 TTTTCTCCCCTGCGAATGACTGG + Intergenic
1133189934 16:4126090-4126112 CTTAATTCCCTGATAAAAACTGG + Intergenic
1138042458 16:53687543-53687565 TTTTATTCCCAGAAAATCACAGG - Intronic
1139045680 16:63056392-63056414 TTATAGTCCCTGAAATTAACAGG - Intergenic
1139097760 16:63726147-63726169 TTTTATACACTGAAAATAAATGG - Intergenic
1140320441 16:73946095-73946117 TTTTAATGCCTTAGAATACCTGG + Intergenic
1140567819 16:76064812-76064834 TTTTTTTCCCTTAGGACAACAGG + Intergenic
1140650924 16:77087555-77087577 TTATATTTCCTGAGAAGAATGGG + Intergenic
1141815320 16:86405521-86405543 TATTATTTCCTGAGAAGCACTGG - Intergenic
1145959743 17:28880483-28880505 TTTTAATCCCACAGAACAACGGG - Exonic
1147229880 17:39009817-39009839 TTTTTTTCCCTTAGAGTAGCTGG + Intergenic
1148963255 17:51411243-51411265 ATTTTCTCTCTGAGAATAACAGG + Intergenic
1149821865 17:59788121-59788143 TTTTTTTCCCTGCTAATGACTGG - Intronic
1150732431 17:67707510-67707532 TTTTATATTCTGACAATAACAGG - Intergenic
1153086929 18:1298715-1298737 TCTTATCCCATGAGAACAACTGG - Intergenic
1153578291 18:6545052-6545074 ACCTATTCCCTGAGAATACCTGG - Intronic
1153916630 18:9751465-9751487 TTTGATACACTGAGCATAACTGG + Intronic
1155558063 18:27043631-27043653 TTTAATTACCCAAGAATAACAGG - Intronic
1157150912 18:45216823-45216845 TTTGATTCTCTGAGAATCAAAGG - Intronic
1158084181 18:53630690-53630712 TTTTATTCTTTGATAATAACTGG - Intergenic
1159778855 18:72637762-72637784 TTTCATTCCCTGAGAGAAATAGG + Intronic
1164936146 19:32215628-32215650 TTTTATTCCTTGAGACCAATGGG + Intergenic
1165368592 19:35387085-35387107 TTTTATAACCTGTGAATATCAGG + Intergenic
1165533139 19:36421004-36421026 TTTAATTCTCTAGGAATAACGGG + Intergenic
1168224978 19:54988221-54988243 TCTTTTTGCCTGAGAATAATGGG + Intronic
926790555 2:16567092-16567114 TTTTATCCCCAGAGAAACACTGG - Intronic
928818607 2:35331066-35331088 TTTTATAACCTGTGAATATCAGG - Intergenic
929663994 2:43819504-43819526 TCTTAATTCCTAAGAATAACTGG + Intronic
930370499 2:50495095-50495117 TTTTCTACATTGAGAATAACAGG + Intronic
931280490 2:60787031-60787053 CCTTATTCCCTGGGAATGACTGG - Exonic
931493244 2:62772858-62772880 GTTTATTCCCTGGCAGTAACTGG + Intronic
933125058 2:78594019-78594041 ATTGATTGCCTGAGAAAAACAGG - Intergenic
933485700 2:82920749-82920771 TTTTGATACCTGAGAATAAATGG - Intergenic
934047352 2:88183699-88183721 TTTTATTCCCTTGGAATGATAGG + Intronic
934621594 2:95813038-95813060 TTATAATCCCTGAGAATTCCTGG - Intergenic
934811846 2:97285779-97285801 TTATAATCCCTGAGAATTCCTGG + Intergenic
934825845 2:97422161-97422183 TTATAATCCCTGAGAATTCCTGG - Intergenic
934992683 2:98932697-98932719 TTTTATTACCTGAAAAAGACTGG - Intronic
936581344 2:113703702-113703724 TTTTGTTTCCTGGTAATAACTGG + Intergenic
936615471 2:114043487-114043509 TTTTATACTCTAGGAATAACTGG - Intergenic
937146474 2:119649687-119649709 TTTTATTCCCTGAGTGTCACAGG + Intronic
937360071 2:121223539-121223561 TTTTATTTCCTGGCAATCACGGG - Exonic
937379104 2:121360224-121360246 TTATATTCCCAGACAAAAACTGG - Intronic
938085306 2:128396047-128396069 TATTACTGCCTGTGAATAACTGG + Intergenic
938668837 2:133567398-133567420 TTTAAATCCCAGAGAATATCTGG + Intronic
939071435 2:137548989-137549011 TCTTAACCACTGAGAATAACAGG + Intronic
939249960 2:139670302-139670324 TTTTATAGCCTGTGAATATCAGG + Intergenic
940485743 2:154293056-154293078 TTTAATTCCCTGTGGATAATAGG + Intronic
940541377 2:155024472-155024494 TTTTTTTCCCTTATAACAACGGG - Intergenic
941683915 2:168428296-168428318 TTTATTTCCCTGAGAAATACAGG - Intergenic
942666747 2:178327787-178327809 TGTTATTCCCTGTTAATAGCAGG + Intronic
943551293 2:189343672-189343694 TTTCATAACCTGAGAATATCAGG + Intergenic
944765678 2:202862029-202862051 TATTTTTCCCTAAGAGTAACTGG + Intronic
944863152 2:203834630-203834652 TGTTATTTGCTGAGGATAACGGG - Intergenic
945179510 2:207077429-207077451 TTTGATTGCCTGATGATAACAGG - Exonic
945205500 2:207327428-207327450 CTTTATTCCCAGAGAATAACTGG - Intergenic
945568143 2:211430163-211430185 TTATATGACATGAGAATAACTGG + Intronic
946798341 2:223381285-223381307 TTTTATAGCCTGTGAATATCAGG - Intergenic
946968259 2:225063373-225063395 TTTTATTCCTTGAGAATTACAGG - Intergenic
947516416 2:230808713-230808735 TTATATTTCCTGATCATAACAGG - Intronic
948099722 2:235364233-235364255 TTTTCTTGCCTGTGAAAAACAGG - Intergenic
1172634404 20:36400531-36400553 TTTTATTTCAGGAGAATAAAAGG + Intronic
1172729751 20:37076176-37076198 ATATATTCCCTGAGGATAAATGG - Intronic
1173889780 20:46497572-46497594 CCTTATTCCCTGCAAATAACAGG + Intergenic
1175469468 20:59216791-59216813 ATTTTTTTCCTGAGAACAACAGG + Intronic
1175557121 20:59872646-59872668 ACGTATTCCCTGAGAATAAGGGG + Intronic
1175574838 20:60052999-60053021 TTATATTCCCTGGGAATAACAGG + Intergenic
1177357204 21:20023723-20023745 TTTTATTCCCAGAAAATTTCTGG - Intergenic
1178956342 21:37025626-37025648 ATTTATTTCATGAGAATAAAAGG - Intergenic
1178990166 21:37346960-37346982 TTTTTTTTCCTGAGAACACCTGG + Intergenic
1179188979 21:39107426-39107448 TTTTCTTCCCTGATAAAGACAGG + Intergenic
949328290 3:2891781-2891803 TTTTATTCTCTGAGTAAAATGGG + Intronic
950255486 3:11501630-11501652 ATATATTCCCTGAGAATAAAGGG - Intronic
950390694 3:12694246-12694268 TTTTAAGCCATGAAAATAACAGG - Intergenic
950924258 3:16724380-16724402 ATGTATTCCCTGTGAATAAGCGG - Intergenic
951391711 3:22112801-22112823 GTTCATTCCCTGAGTAAAACAGG - Intronic
951661828 3:25075283-25075305 TTTTATTAACTGAGAAAGACGGG - Intergenic
951914134 3:27781687-27781709 AGTTATTCACTGAGAATAAAAGG - Intergenic
951999033 3:28763741-28763763 TTTTAGTCCCTGAGAAGCCCTGG + Intergenic
953440654 3:42913994-42914016 GTTTATACCATGAGAAGAACAGG - Intronic
953802578 3:46036850-46036872 TTTTATAACCTGTGAATATCAGG - Intergenic
954402721 3:50327585-50327607 TATTATCCCCTTGGAATAACTGG + Intronic
955130113 3:56157731-56157753 TTTTTTTCCATGAGACAAACTGG - Intronic
957145925 3:76423641-76423663 TTTTATAACCTGAGAATTTCTGG + Intronic
957247147 3:77730107-77730129 TTTTATTACCTGAAACTCACTGG - Intergenic
957961191 3:87255720-87255742 GTTTAATCCCTGAGAATACTGGG - Intergenic
958132881 3:89452041-89452063 TTTTATTCCCTGTGGATTTCAGG - Intronic
959086579 3:101856619-101856641 TTTTATTCACTGAGTATATGGGG + Intronic
959321375 3:104879484-104879506 TTTTATTGCATGAAAATATCTGG - Intergenic
959478060 3:106836443-106836465 TTTTATACCCTGTGAATATGAGG + Intergenic
959983743 3:112549111-112549133 TTTTATCCATTGTGAATAACTGG - Intronic
960114108 3:113875992-113876014 TTGTATTCTCTGAGAAAAACAGG - Intronic
960338075 3:116442743-116442765 TTTCTTTCCCAGAGAATAAGTGG + Intronic
960877565 3:122312403-122312425 TTATATTCCCTGATGATCACAGG - Intergenic
962425660 3:135267077-135267099 TTTTCTTCCCTGAAAGTAAAGGG + Intergenic
962477778 3:135771790-135771812 AATTATTCTCTGAGAATAAGAGG + Intergenic
965372857 3:167886086-167886108 TTTAATTACCTGAAACTAACTGG - Intergenic
966052050 3:175630680-175630702 TTTTTTTCACTGAGGATAAATGG + Intronic
966057197 3:175708807-175708829 TTTTATTCTCTGGGTATAAAAGG - Intronic
966479386 3:180388942-180388964 TTTCTTTCCCTGAGACTAAAGGG - Intergenic
966873332 3:184306705-184306727 TTTTATTCCTTGAGCTTAATGGG + Intronic
967334124 3:188323469-188323491 TTTTCTTCCCAGAAAATAAGTGG - Intronic
967733022 3:192923537-192923559 TTTGCTTCCCTGAGTATAGCAGG - Intergenic
967907566 3:194514285-194514307 TCTTATTCACTGAGAAGAAAAGG - Intergenic
968254864 3:197260031-197260053 GTTTTTTCCCTGAGATTTACAGG - Intronic
968261611 3:197329504-197329526 TTTTCTTGCCTGAGAACAAGGGG - Intergenic
969667584 4:8569992-8570014 TTTTATAGCCTGTGAATATCAGG + Intronic
970322578 4:14889533-14889555 GTTTATTCCCTGATTTTAACTGG + Intergenic
970848411 4:20571691-20571713 TTATATTCCCTGAGCATAGCAGG - Intronic
971193525 4:24449909-24449931 TTTTATTCCCTGCAAATAAATGG + Intergenic
971706017 4:30044588-30044610 TTTCTATCCCTGAGACTAACTGG - Intergenic
971804562 4:31339119-31339141 TTTTGTTCCATGCAAATAACTGG - Intergenic
971845048 4:31907499-31907521 TTTTTTCCCCTCAGAATAAAAGG - Intergenic
972019170 4:34287668-34287690 ACTTATTCACTGAGAATAAGAGG + Intergenic
972210415 4:36830056-36830078 TTTTATTTCCTGAGAATTTCTGG - Intergenic
972266150 4:37461903-37461925 CTTTATTCCCTTAGAAGATCTGG - Intronic
973553829 4:52061808-52061830 TTTTTTTCCCTGAGAATTTATGG + Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975311654 4:72910317-72910339 TTTTCTTCCCTCAGAAAAACAGG - Intergenic
976161343 4:82202273-82202295 TTTAATTCCCTTTGAATACCTGG + Intergenic
976350502 4:84054952-84054974 TTTTTTTCCCTGGGAAAATCGGG - Intergenic
976926379 4:90502654-90502676 TTTTTTTCCTTGAGAAAAAGTGG - Intronic
977868347 4:102058594-102058616 TTGTATACCCTTAGAATAAAAGG + Intronic
978015864 4:103745380-103745402 TTTTATAGCCTGTGAATATCAGG - Intergenic
978631752 4:110755152-110755174 TATTATTCATTGTGAATAACTGG - Intergenic
979965484 4:127071880-127071902 TTTATTTCCCTAACAATAACTGG + Intergenic
981590877 4:146359476-146359498 TTTTATTACCTGAAAATGACTGG + Intronic
981594931 4:146409206-146409228 TTTTATTTACTGAGAAACACTGG - Intronic
983138093 4:164110441-164110463 ATTTATGCCCTTAGAATTACTGG + Intronic
984086873 4:175324346-175324368 ATTAATTTTCTGAGAATAACTGG + Intergenic
985279619 4:188272232-188272254 TTAGATTCCCTAATAATAACAGG - Intergenic
987338284 5:16916620-16916642 TTTTATTTGCTGAAAATAAATGG - Intronic
987561452 5:19527902-19527924 TATTATTACCTGAGAGTAACAGG + Intronic
988011430 5:25492223-25492245 TTTTATAACCTGTGAATATCAGG + Intergenic
988943349 5:36168498-36168520 TTTTTTTCCCTGTATATAACTGG + Intronic
989369289 5:40688938-40688960 TTTTATTCTCTGAGATTTACAGG + Intronic
989388195 5:40873831-40873853 CTTACTTCCCTGAGAAAAACAGG - Intergenic
990732563 5:58825414-58825436 TCTTATTCCATGAGAAACACAGG + Intronic
992702458 5:79354522-79354544 TTTTATAGCCTGTGAATATCAGG + Intergenic
994008660 5:94873887-94873909 TTCTATTCACTGAAAATAAAGGG + Intronic
994054664 5:95401713-95401735 TTTGATTCTCTGAGTATTACAGG + Intronic
994763574 5:103887394-103887416 TTTTATGCCCTGATAAAAATGGG + Intergenic
994922227 5:106061590-106061612 TATTATTCCCAGAGCAAAACTGG - Intergenic
995961627 5:117847052-117847074 TTTTATTCCCTTAGAAAGCCTGG - Intergenic
996145214 5:119966366-119966388 TTTCATTCCCTCAGAAGAATAGG + Intergenic
996572713 5:124949515-124949537 TGTTATTACCTGACAACAACAGG - Intergenic
999797841 5:155004764-155004786 TTTTATGGCCTCAGAATAGCAGG + Intergenic
1001862845 5:175073840-175073862 TTTTATAGCCTGTGAATATCAGG - Intergenic
1002783813 6:386230-386252 ATCTATCCCCTGAGAATAAGGGG - Intergenic
1003140840 6:3469889-3469911 CTTTATTCCCTGAACAAAACAGG + Intergenic
1004941853 6:20567403-20567425 TTTGAGTCCCTGAAATTAACTGG + Intronic
1006312843 6:33273093-33273115 TTATATTCCCTGAGAATTGGAGG + Intronic
1006838676 6:37014603-37014625 GTTTATTCCCTGAGAATCTAGGG - Intronic
1008184181 6:48370448-48370470 TTTAATTCACTGACAATAAAAGG - Intergenic
1009603825 6:65839008-65839030 TTTTCTTCTCTGAGAAAAACAGG - Intergenic
1010293275 6:74164986-74165008 TCTTATTCTCTTATAATAACTGG + Intergenic
1010328891 6:74598299-74598321 TTTTATTCCCAGTGCATAAATGG - Intergenic
1010451996 6:76013961-76013983 TTTCATTCCCTGAACATAAGAGG + Intronic
1010578621 6:77565822-77565844 TTTTTTTTCATGAGAACAACAGG - Intergenic
1010810792 6:80296863-80296885 TTTTTTTCCCTAAGATTAAAAGG - Intronic
1011134318 6:84083365-84083387 TTTTATAGCCTGTGAATATCAGG + Intronic
1011925755 6:92643416-92643438 TTTTCTTCCCTGAGGTAAACAGG - Intergenic
1014160996 6:118168287-118168309 ATGTATTCCATGAGAATAAGGGG - Intronic
1014602115 6:123426218-123426240 TTTTATTTTCTGAGAAAAAAAGG + Intronic
1015131709 6:129818677-129818699 TTTTATTCTCTGAAGATTACAGG - Intergenic
1015441808 6:133256976-133256998 ATTGAATCCCTTAGAATAACAGG - Intronic
1015507842 6:134007598-134007620 TTTTATTATCTGAGAGTGACAGG + Intronic
1017405921 6:154118092-154118114 TTTTCTTACCTGAAAATAGCAGG + Intronic
1018885721 6:167934635-167934657 TTTTCTTACCTGAGAACAATAGG + Intronic
1019214068 6:170430883-170430905 TTTTATAGCCTGTGAATATCAGG + Intergenic
1020683080 7:11260551-11260573 TTTTATTGACTGATAAAAACAGG - Intergenic
1021705142 7:23359792-23359814 TTTTATACCCTCAGTAGAACTGG - Intronic
1022410010 7:30132126-30132148 TTTTGTTTCCTTAGAACAACTGG - Intergenic
1022776402 7:33532025-33532047 TGGTATTCCCTGAGAGTGACTGG - Intronic
1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG + Intergenic
1024872278 7:53978215-53978237 TTTTATTTTGTTAGAATAACAGG + Intergenic
1026069799 7:67108611-67108633 TTTTATTTTCTGAGAGAAACGGG + Intronic
1026123624 7:67559830-67559852 TTTTATTTCCAGAGCATAAAGGG - Intergenic
1026713112 7:72760956-72760978 TTTTATAGCCTGTGAATATCCGG - Intronic
1031513978 7:122679893-122679915 TTTTAGTCCCTGAGAAAGAAGGG + Intronic
1033017775 7:137689488-137689510 TTTTTTTCCCAGAGGATTACAGG - Intronic
1033155408 7:138952454-138952476 TTTTACTGGCTGAGAAGAACAGG - Intronic
1033757192 7:144404730-144404752 TTTTATTCTCTGAGAATGGAAGG + Intronic
1034999217 7:155598289-155598311 TTTTATTCACTTAAAATAATTGG - Intergenic
1037150442 8:15628656-15628678 TTTTATTCACTGAGAAGCAATGG + Intronic
1037253966 8:16930409-16930431 GTTTTTCCCCTGTGAATAACTGG - Intergenic
1037391475 8:18396808-18396830 TTTTATAGCCTGTGAATATCAGG - Intronic
1038527202 8:28286021-28286043 CTCTATTCCCTGAGAACAATTGG - Intergenic
1039611588 8:38923536-38923558 TTTCATTTCCTGAGAATAGAAGG + Intronic
1040764020 8:50884780-50884802 TTTTATTTCGTGAGTATAAAAGG + Intergenic
1041438918 8:57873113-57873135 TTTTCTTCGGTGAGAAAAACAGG - Intergenic
1042080042 8:65041714-65041736 TTTTATTCCTTGAAAATAAGAGG - Intergenic
1042310254 8:67372160-67372182 TCTTATTCCCAGAGAATAGGAGG + Intergenic
1042492689 8:69418303-69418325 TTTTCCTCCTGGAGAATAACAGG + Intergenic
1043331596 8:79123640-79123662 TAATATTACCTGAGAATGACAGG + Intergenic
1043346116 8:79299780-79299802 TTTTATACCCTGGGAAACACAGG + Intergenic
1044891618 8:96842144-96842166 TTTTATTCCCTGAGAATAACTGG - Intronic
1045829785 8:106445073-106445095 TTTAATTCCCTGTAAATAAATGG - Intronic
1046165217 8:110424902-110424924 TATTCTTCCCTGATAATTACTGG + Intergenic
1047331263 8:123889254-123889276 TTTTATAACCTGTGAATATCAGG - Intronic
1050816316 9:9817653-9817675 TTTTATTCCCTGTGGACAATGGG - Intronic
1051459959 9:17300824-17300846 TTTTATTCCTTGAACATAACAGG + Intronic
1051571883 9:18567641-18567663 GCATATTCCCTGAGAATAAGGGG - Intronic
1053607673 9:39677723-39677745 AGTTATTCCCTGAGACAAACAGG - Intergenic
1053865517 9:42434078-42434100 AGTTATTCCCTGAGACAAACAGG - Intergenic
1054245861 9:62664683-62664705 AGTTATTCCCTGAGACAAACAGG + Intergenic
1054559987 9:66699216-66699238 AGTTATTCCCTGAGACAAACAGG + Intergenic
1055385085 9:75753010-75753032 TTTTATTCACTGAGATTTGCAGG + Intergenic
1055765221 9:79655761-79655783 TATTATGACCTCAGAATAACTGG - Intronic
1057987976 9:99736887-99736909 TTTTAATCCCAGAGAAGTACAGG + Intergenic
1058314883 9:103553661-103553683 ATTCATTCCCTCAGAGTAACTGG - Intergenic
1059023613 9:110601716-110601738 TTTTCATCCCTGAGAAAGACAGG + Intergenic
1059624533 9:116048337-116048359 TTTTCTTACCTGAGAATTTCAGG - Intergenic
1059782041 9:117539857-117539879 CTATATTCCCTGAGGATAAATGG + Intergenic
1060534406 9:124372593-124372615 TTTTATTTCCTGAAATTAAATGG + Intronic
1060604003 9:124898000-124898022 TTTCATTCCCTAAACATAACTGG - Intronic
1186260687 X:7775818-7775840 TATGATTCCCTTAGAATAAAAGG - Intergenic
1186839083 X:13467163-13467185 CTTTATTTCCTCAGAATTACTGG - Intergenic
1187978931 X:24734005-24734027 TTTTACTACCTGAAAATAATGGG + Intronic
1188703661 X:33299159-33299181 TTTTTTTTCCTGAGAGTAAGTGG + Intronic
1189008351 X:37018602-37018624 TTTTATTCTCTGAGAAAGAAGGG - Intergenic
1190663782 X:52679135-52679157 TTCTATTCCCTGTGCATCACAGG - Intronic
1190675641 X:52779287-52779309 TTCTATTCCCTGTGCATCACAGG + Intronic
1192280986 X:69685394-69685416 TTTTATTAGCTGATAATATCTGG + Intronic
1192754295 X:74030621-74030643 TTTTATTCCCTGAAAAGTTCAGG - Intergenic
1193291969 X:79785178-79785200 ATTTATTCCCTGAATTTAACTGG + Intergenic
1194078301 X:89425692-89425714 TTCTATTCCCTGTGACTCACAGG + Intergenic
1194937409 X:99968025-99968047 TGTTATTCCCTAATAATAATGGG - Intergenic
1195137575 X:101924690-101924712 TCTTATACCCTGAGTATAAATGG - Intronic
1195436472 X:104849478-104849500 TTTTATAGCCTGTGAATATCTGG + Intronic
1195780493 X:108458046-108458068 TTTTATTCTCTGAAAATTATAGG - Intronic
1196460779 X:115927753-115927775 TTTTATTGCCTGTTAATATCAGG - Intergenic
1197568859 X:128123443-128123465 TTTTAGTCCCAGTGAATTACAGG - Intergenic
1197881569 X:131172065-131172087 TTTTTTTTCCTGAGAGTAATAGG + Intergenic
1198198773 X:134393342-134393364 TTTTCTCTCCTTAGAATAACCGG - Intronic
1198445562 X:136710433-136710455 TTTTATTCTCTCAGAGTTACTGG - Intronic
1200430944 Y:3081224-3081246 TTCTATTCCCTGTGACTCACAGG + Intergenic
1200495882 Y:3882963-3882985 TTTTACTCTCTGGGCATAACAGG - Intergenic
1200742455 Y:6868691-6868713 CTTTATTCCCTGAAAATATTAGG - Intronic
1200867398 Y:8059534-8059556 TTTTATTCTCTCAAAAGAACAGG + Intergenic
1200894558 Y:8361049-8361071 TTTTATTCTCTCACAAGAACAGG - Intergenic