ID: 1044892471

View in Genome Browser
Species Human (GRCh38)
Location 8:96851895-96851917
Sequence CTGAATAAAGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 0, 2: 9, 3: 84, 4: 938}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044892471_1044892474 -10 Left 1044892471 8:96851895-96851917 CCCTCTTCCTTCTCTTTATTCAG 0: 1
1: 0
2: 9
3: 84
4: 938
Right 1044892474 8:96851908-96851930 CTTTATTCAGTATCTTCCTCTGG No data
1044892471_1044892476 13 Left 1044892471 8:96851895-96851917 CCCTCTTCCTTCTCTTTATTCAG 0: 1
1: 0
2: 9
3: 84
4: 938
Right 1044892476 8:96851931-96851953 CAAATAGCAGTTACTAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044892471 Original CRISPR CTGAATAAAGAGAAGGAAGA GGG (reversed) Intronic
901914588 1:12488223-12488245 CTGAATAAAGGTAGGAAAGAGGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903293755 1:22330754-22330776 ATGAATGAAGAGAAGAGAGAAGG + Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904351143 1:29907463-29907485 CTGAAAAAAGGTAAGGAAGTTGG - Intergenic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905231882 1:36519657-36519679 CTGGAAAGAGAAAAGGAAGAAGG + Intergenic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
906785324 1:48610622-48610644 GTGCATAATGACAAGGAAGATGG - Intronic
906976637 1:50581464-50581486 AGGAATAAAGAAAGGGAAGAAGG - Intronic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
908028562 1:59975857-59975879 CAGAATATAGAAGAGGAAGAAGG - Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908878539 1:68704667-68704689 CTGAAGAGAGAACAGGAAGATGG + Intergenic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909091534 1:71232187-71232209 CTGAAGAAAGAGAAGAAAATGGG - Intergenic
909275212 1:73675046-73675068 GTGAATGAAGAAAAGAAAGAAGG + Intergenic
909845278 1:80386428-80386450 CTCAAGCAAGAGAAGGAAAATGG + Intergenic
910039607 1:82833996-82834018 CTGAAGAGAGAAAAGGATGAAGG - Intergenic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
911633102 1:100204654-100204676 CTAAACAAAAAGAAGGAAGCTGG + Intronic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
912228489 1:107763886-107763908 CTGAACAAAGAAAAGGAAAAGGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914238817 1:145837294-145837316 CTCAAAAAAGAAAAGGAAAAAGG + Intronic
914430252 1:147614104-147614126 CTGAAATAAGAGAAGTTAGAGGG + Intronic
914850987 1:151314134-151314156 GTGACTAGAGAAAAGGAAGAGGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915168129 1:153959922-153959944 CTGACTAATGAGAGGGAAGTGGG - Exonic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
915998416 1:160589139-160589161 AGGAAGCAAGAGAAGGAAGAAGG - Intergenic
916012542 1:160719026-160719048 CTGGATAAAAGGAAGTAAGAGGG + Intergenic
916099757 1:161384390-161384412 CTGACAAAAGACAAGGGAGAGGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916421179 1:164639226-164639248 ATGATTAAAGAGTAGGAAGTTGG + Intronic
916633180 1:166638522-166638544 CTTAGTGAAGAGAAGAAAGATGG - Intergenic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917034060 1:170726846-170726868 TTGAATTAAAAAAAGGAAGAAGG + Intronic
917039800 1:170792265-170792287 GTGAATAGAAAGAAGGAATAAGG + Intergenic
917101177 1:171447047-171447069 AGGAATAAAGAGAAAAAAGAAGG + Intergenic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
917833564 1:178920428-178920450 CTGAAATAAGAGGAGCAAGAGGG - Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918537835 1:185594101-185594123 CTGAATAAAAAGAAGGAATCAGG - Intergenic
919469148 1:197957411-197957433 CTGAGTAAAGACCTGGAAGAGGG + Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920437348 1:205956064-205956086 ATAAAGAAAGAGAAGAAAGAAGG - Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921866177 1:220090000-220090022 CTAAAAAAAGAAAAAGAAGAAGG + Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921919548 1:220651126-220651148 CTGAATGATGAGAAATAAGATGG - Intronic
921985851 1:221311074-221311096 CTGACTAGTGAGAAAGAAGATGG - Intergenic
922004656 1:221517608-221517630 CAGAATAAAGACAATGAACAAGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922848284 1:228708073-228708095 ATGAATAAAATGAAGGGAGAAGG + Intergenic
923062147 1:230485554-230485576 ATGAAAAAAGAGAAGGAAAAAGG - Intergenic
923413814 1:233735120-233735142 ATTAATAAAGTGAAGGAATAAGG - Intergenic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
924111882 1:240708208-240708230 ATGAAGAACGAGAAGAAAGACGG + Intergenic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064692969 10:17936746-17936768 TTGAATAAAGAGAACAGAGAAGG - Intergenic
1064761806 10:18628670-18628692 CTGAATGAAATGAAGCAAGAAGG + Intronic
1064867548 10:19898135-19898157 CTCAATAAATACAAAGAAGAGGG + Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065611905 10:27480081-27480103 CTGCTTAAAGAAAAGGAAGTAGG + Intergenic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1065850903 10:29787375-29787397 CTGCAAAAAGAGAAGGTAAAAGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068454309 10:57235384-57235406 GTCAAGAAAGAGAAGAAAGAGGG - Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1069099772 10:64305875-64305897 CTTAATAAAGAAGAGGTAGATGG + Intergenic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1069971406 10:72173254-72173276 AAGAATAAAGAGAAAGAAAAAGG - Intronic
1070004949 10:72414847-72414869 CTGATTAAAAGGCAGGAAGAGGG - Intronic
1070269434 10:74938471-74938493 GTGGAAAAAGAGAAGAAAGAAGG + Intronic
1070640112 10:78162252-78162274 CTGAATAAAGATTAAGAATATGG - Intergenic
1070694987 10:78556015-78556037 CTGAATAAAGGTAAAGATGAAGG - Intergenic
1071188621 10:83074989-83075011 CTGAATAAACACCATGAAGATGG + Intergenic
1071227664 10:83549752-83549774 CAAAATAAAAAGAATGAAGATGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072139386 10:92576008-92576030 CTCAATAAAGAGGAGGTGGATGG + Intergenic
1072152455 10:92694524-92694546 CTGAATAAAGGAAATGAAAATGG - Intronic
1072947656 10:99825025-99825047 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1073135589 10:101218341-101218363 CTCATTAAAGAGAAGAAAGTTGG - Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073764768 10:106669858-106669880 CTGAATAAATAGTACTAAGAAGG - Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1075004900 10:118823081-118823103 CCTAACAAAGAGAAGGAACAGGG - Intergenic
1075112927 10:119602575-119602597 GTGAAAATAGAGAAGGAAGGAGG + Intergenic
1075350274 10:121718186-121718208 CTAAATGAAGAGAAAGAATAAGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075502691 10:122990592-122990614 TTGAATAAAGAGAAGAAACTAGG + Intronic
1075839919 10:125492738-125492760 CTGAATAAAGAGATCAAAGGAGG + Intergenic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1076656641 10:132028505-132028527 TTGCAAGAAGAGAAGGAAGAGGG - Intergenic
1077922208 11:6650108-6650130 AGGAAGAAAGAGAAGAAAGAGGG - Intronic
1078129032 11:8596651-8596673 CTGAATGATGAGAAGGAACCAGG - Intergenic
1078312661 11:10260875-10260897 CTCAAAAAAGAAAAGAAAGAAGG + Intronic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079275952 11:19037957-19037979 CTGAAGCAAGCCAAGGAAGAAGG - Intergenic
1079808327 11:24962491-24962513 ATGAATGAAGTGAAGCAAGAAGG - Intronic
1079932949 11:26587596-26587618 CTGAAAAGAAAGCAGGAAGATGG - Intronic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080617822 11:33960291-33960313 CTTCATAAAGAGAAGGGAGAGGG + Intergenic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1080849308 11:36054644-36054666 CTGCTTAAAAAGAATGAAGATGG + Intronic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081442864 11:43099725-43099747 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082596288 11:55085784-55085806 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083525678 11:63362357-63362379 CTGATTAAAGAAGAGGACGAAGG - Intronic
1084365504 11:68694993-68695015 TTGAATTAAGGGAAGGTAGATGG - Intergenic
1085666057 11:78417048-78417070 CGGAATAAAGGGAAAGAAGGGGG + Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086538258 11:87876348-87876370 GTGAAAGAAGAGAAGGAAAAAGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087580742 11:100048666-100048688 CTAGATAAAGAGAAGTAAAATGG + Intronic
1087724175 11:101698946-101698968 ATCAAAAAAGAGAAGGAATAGGG + Intronic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088551505 11:111018118-111018140 CTGAAAAAAGAAAAAGAAAAAGG - Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1089147043 11:116336679-116336701 CTGAATAAAGGGAAGGGAGCTGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089336016 11:117724507-117724529 ATGAATAAAGAGTAGCAAGAGGG - Intronic
1089471665 11:118726274-118726296 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1089545101 11:119218070-119218092 CTAAATAAAGGAAAGGAAAAAGG + Intronic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089937694 11:122382436-122382458 CTGATGAAAGAAATGGAAGAGGG + Intergenic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1090904221 11:131060128-131060150 GTGAATAAAAAGGAGGAATATGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1093110183 12:15142684-15142706 CTCAAGAAAGAGAAGAGAGAGGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1094804901 12:34080200-34080222 CTGGAGAAAGAAAAGAAAGAAGG + Intergenic
1095657697 12:44689639-44689661 CTAAATAAAGAAAAGGAGCATGG - Intronic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1096920429 12:55079569-55079591 CTGAATAAAAAGAACAAAGCTGG + Intergenic
1096923692 12:55117972-55117994 CTAAATAAAGAGAAAAATGAGGG + Intergenic
1097331006 12:58333010-58333032 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1097366602 12:58721285-58721307 ATGAATAAAGAGCGGGAAAATGG - Intronic
1097640232 12:62172250-62172272 CTTAATAAAGCGGAGGATGAAGG - Intronic
1097801585 12:63920399-63920421 GTGAATAAAGAGAAGTGAGCTGG + Intronic
1097861768 12:64524881-64524903 CTGAATAAAGAGGATGAAGCTGG - Intergenic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1098058102 12:66529915-66529937 CTGAATAAAGGAAAGAGAGAAGG + Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1098796257 12:74891958-74891980 ATGAATAAAAATAAAGAAGAAGG + Intergenic
1098898293 12:76086659-76086681 CTGAAAAAAGAAGAGGAAGCTGG - Intergenic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099741151 12:86635975-86635997 CTAAATATAGAAAAGGAACAGGG - Intronic
1099795283 12:87392699-87392721 CTGAAAAAAAAGGAAGAAGAAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099951222 12:89306587-89306609 TTTAATAGAGAGAAGGAACAGGG + Intergenic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1101606532 12:106250953-106250975 ATGAATAGAGAGTAGGACGATGG + Intronic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102803012 12:115753171-115753193 AGAAATATAGAGAAGGAAGAAGG - Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103277244 12:119722800-119722822 CTGAATGGAGGGAAGAAAGAAGG - Intronic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1104059013 12:125252292-125252314 CTCACTAGAGAGAAGGGAGAGGG - Intronic
1105042266 12:132969787-132969809 CAGAATAAAAAGCAGGCAGAGGG + Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106402533 13:29443908-29443930 CTGAATTCAGACAAGGAAGAAGG + Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106681446 13:32012537-32012559 AGGAATAAAGTGAAGGATGAGGG - Intergenic
1107293402 13:38883124-38883146 GGGAATAAAGGGAAGGAAAAAGG - Exonic
1107367287 13:39696355-39696377 CTGAAGAAAAAGCAGGAAAAAGG + Intronic
1107793978 13:44031215-44031237 CTCAAAAAAAAGAAGAAAGATGG - Intergenic
1108389457 13:49934181-49934203 CTGAATAAAATGAAAGAAAAGGG - Intronic
1109227960 13:59719720-59719742 CTGAATAAAGAAATGACAGATGG + Intronic
1109522136 13:63527523-63527545 CTGAATATGGCCAAGGAAGAAGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113243715 13:108369936-108369958 CTGAATAAAGAAAAAAAAGGGGG + Intergenic
1113317576 13:109199085-109199107 CTGAATATTGAGAAGTGAGATGG - Intronic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913997 14:27239094-27239116 GTGAATAAAGAAATGCAAGAGGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115398307 14:32933568-32933590 CGGAAGAAAGAGGAGGAAGTGGG + Intergenic
1115435645 14:33369989-33370011 ATGAAGAAAGAGTAGGAAGGAGG - Intronic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1116280103 14:42895797-42895819 CTAAATAAAAAGAATGAAGCTGG - Intergenic
1116553476 14:46272435-46272457 ATGAAGAAAGGGAAGGGAGACGG + Intergenic
1116596913 14:46860993-46861015 ATGAATAAAGAGGAAGAAAATGG - Intronic
1116930910 14:50689479-50689501 TTGAATCAAGAGAAGTGAGATGG + Intergenic
1116958485 14:50946529-50946551 CTGAATTAAGAGTGGGAAGGGGG + Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118505067 14:66402327-66402349 AGGAATTAAGAGAAGGAAGGTGG - Intergenic
1118527682 14:66663865-66663887 ATCAATAAAGACAAAGAAGAAGG + Intronic
1118562672 14:67103301-67103323 CTGAATAAAAAGAAGAAAACTGG - Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119890196 14:78176814-78176836 CTGAAGAAAGAGAACTAAGAAGG - Intergenic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120077756 14:80179455-80179477 AAAAATAAAGAAAAGGAAGAGGG + Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121233812 14:92377864-92377886 CTGAATGAAGGTGAGGAAGAAGG + Intronic
1121399183 14:93657159-93657181 CTGAATAAATCCAAGCAAGAAGG + Intronic
1121567315 14:94919890-94919912 CTATATAAAGAGTACGAAGAAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121847365 14:97184745-97184767 CTGAAGAGAGAAAAGGAAAATGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122173462 14:99897480-99897502 ATAACTAAAGAGAAGGAAGAGGG + Intronic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125214163 15:37250615-37250637 CTGAGTAAGGAGACAGAAGATGG - Intergenic
1125617630 15:41029777-41029799 CTGAATAATTAGGAGGAAAAAGG + Intronic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127027523 15:54823896-54823918 TTGAGCAAAGAGAAGAAAGATGG - Intergenic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128792980 15:70446768-70446790 CTGAACTGAGAGAAGGAAAAGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130874383 15:87999737-87999759 CTGAATTCAGATGAGGAAGATGG + Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131105478 15:89731287-89731309 CTTCATAAAGAGAAGGATGATGG + Intronic
1133062571 16:3184111-3184133 GGGAAAAAAGAGAAGGAAAAGGG + Intergenic
1133063088 16:3188165-3188187 GGGAAAAAAGAGAAGGAAAAGGG - Intergenic
1133385682 16:5368418-5368440 CTGAAGAAAAACAAGGAAGTGGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133713584 16:8426061-8426083 CTGAATAAAGTGAAAGTAAATGG - Intergenic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136071192 16:27788278-27788300 CTCAAGAAAGAGAAGAAAGTGGG - Exonic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137774074 16:51041082-51041104 AGGAATGAAGACAAGGAAGAAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138313539 16:56048912-56048934 CTGAAGTAAGAAAAGGAGGAAGG - Intergenic
1138526328 16:57609666-57609688 CTGAAGAAAGAGAGGGCAGGTGG - Intergenic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139742012 16:69043557-69043579 GTGAATAAAGAAAAGGAAATGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141265189 16:82490106-82490128 CAGAATAAAAAGCAGGCAGAAGG + Intergenic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1141861170 16:86717609-86717631 CTAAGCAAAAAGAAGGAAGATGG + Intergenic
1142167213 16:88598594-88598616 TTGAAAAACGAGAAGGGAGAAGG - Intronic
1142779213 17:2167872-2167894 CTGAAAAAAAAGAAAGAAAAAGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144074253 17:11702689-11702711 CAAAATAAAGAGGATGAAGAAGG + Intronic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144087551 17:11824323-11824345 CTGAATCAAGAAATTGAAGAGGG - Intronic
1144440784 17:15279370-15279392 GGGAAGAAAGAGAAGGTAGAGGG + Intergenic
1144802567 17:17940577-17940599 CTGAACAAAGAGCAGGAATAAGG + Intronic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1147034601 17:37670802-37670824 CTGAATAAAGACAATGACCAAGG - Intergenic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1147441973 17:40452975-40452997 CTGAATACAGACAAGGACGAGGG + Exonic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1149034298 17:52116562-52116584 GGGAATAAAAAGATGGAAGAAGG + Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150035057 17:61786128-61786150 GTGAAGAGAGAGAAGAAAGAAGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1152797976 17:82317255-82317277 CTCATTTAAGAGAAGGAAAAAGG - Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153179701 18:2419176-2419198 CTAAATAGAGAGGAGGAAAAAGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153461770 18:5342514-5342536 CATAATACAGAAAAGGAAGATGG - Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1154192548 18:12242926-12242948 CTGAAGAAAGAAAGGGGAGAGGG - Intergenic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155472785 18:26208338-26208360 CTGAAGAAAAAGAAGGGAGTGGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155723946 18:29055238-29055260 CTGTAAAAAGATAAGGAAGGGGG + Intergenic
1155859418 18:30878183-30878205 CTGAATTAAGATAAGGACAAAGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157583178 18:48785113-48785135 AGGACAAAAGAGAAGGAAGAAGG - Intronic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1159124326 18:64205554-64205576 TTGAAAAAAGAAAATGAAGAAGG - Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159785205 18:72705307-72705329 CTAAATGGAGAGAAGAAAGAAGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1163000282 19:14362789-14362811 ACGAAGAAAGAGAAGAAAGAAGG + Intergenic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1164283153 19:23786993-23787015 CTTAATAAAGACAGGAAAGATGG + Intronic
1164370898 19:27643515-27643537 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165265488 19:34659838-34659860 CTAAATAAAAAGAACAAAGATGG + Intronic
1165397713 19:35575956-35575978 ATTAAGAAAGAGAAGGAATAGGG - Intergenic
1165405230 19:35626613-35626635 TTCAATAAAGAGAAGGCAAAAGG + Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166076930 19:40419167-40419189 CTGAATGAAGGACAGGAAGAAGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167684405 19:50947105-50947127 CTGAATACAGAGAAGGGTGCTGG + Intronic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926654271 2:15383329-15383351 CATAAAAAAGACAAGGAAGAGGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926769960 2:16362161-16362183 CTGAAGATAGAGAATGAATAAGG - Intergenic
926821533 2:16856056-16856078 ATGAAAAAAGAAAAGGAAAATGG - Intergenic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927358390 2:22202576-22202598 CTGAAAAAAAAAAAGCAAGAAGG + Intergenic
927709158 2:25314434-25314456 GTGAATGAAGAGAAGGGAGGAGG - Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928893819 2:36238300-36238322 TTGGAAGAAGAGAAGGAAGATGG - Intergenic
928950506 2:36809155-36809177 CTGAGTAGGGAGAAGGAACAAGG + Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
930837595 2:55811153-55811175 CTGAAGAAAAATAAGGAAAATGG - Intergenic
931015138 2:57968713-57968735 CTGAATAATGAGAAAGAAATTGG + Intronic
931077376 2:58731169-58731191 CTCAATAAAGAAAAGGAAGAAGG - Intergenic
931092246 2:58898806-58898828 CTGAATAGGGACTAGGAAGAGGG - Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931258127 2:60592483-60592505 CTGAATAAAAAGAACAAAGCTGG + Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931269698 2:60690537-60690559 CTAAAGAAAGAGAGGGATGAAGG - Intergenic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
931503573 2:62898760-62898782 AGGAAAAGAGAGAAGGAAGAGGG + Intronic
931565999 2:63616237-63616259 CTGAAGAATAAGAAGGGAGAGGG + Intronic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932733946 2:74241135-74241157 AGGCAGAAAGAGAAGGAAGAAGG + Intronic
932855876 2:75233470-75233492 GTGAATGATGAGAAAGAAGAAGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933569377 2:83991601-83991623 TTGAAGAAAGAGAAAAAAGAGGG - Intergenic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
935028633 2:99301479-99301501 AGGAAGAAAGAAAAGGAAGAAGG + Intronic
935029354 2:99307026-99307048 AGGAAGAAAGAAAAGGAAGAAGG - Intronic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
936259100 2:110943046-110943068 AGGAAGAAAGAAAAGGAAGAAGG + Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936641851 2:114321770-114321792 CTGAATAAATAGCCAGAAGATGG + Intergenic
936848593 2:116868751-116868773 CTGAACAAAGAGAACAAAGCTGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937805528 2:126139240-126139262 AGGAATAAAGACAAGAAAGAAGG - Intergenic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
938420168 2:131139273-131139295 CTGAAGAGAGAGAAGACAGACGG - Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939541139 2:143495220-143495242 CTAAATAAAGAAGAGGAAAAGGG - Intronic
940114319 2:150191619-150191641 TTGAACAGAGAGAAGGAAAAGGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940574868 2:155489964-155489986 ATGAAGAATGAAAAGGAAGATGG + Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940805442 2:158181777-158181799 CTGAAGCTAGAGAAGCAAGAGGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941146179 2:161848822-161848844 CTGAACAAAAAGAATGAAGCTGG - Intronic
941444181 2:165580643-165580665 CTGAATAGTGTGAAGGAAAAGGG - Intronic
941477753 2:165969280-165969302 ATGAATAAAGAGAAGAAATTTGG + Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942058367 2:172205959-172205981 CTGAATTAAGAGGAGAAGGAAGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942525961 2:176853249-176853271 TTGAAAAAAGAGCAGGGAGAGGG - Intergenic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943202939 2:184852884-184852906 TTGAATAGAGAGAACAAAGATGG - Intronic
943650548 2:190453447-190453469 GGGAATAGAGAGGAGGAAGATGG - Intronic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943682427 2:190782562-190782584 CTGAAGTAAGAGGAGGAAAAGGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945639375 2:212404262-212404284 TTGAAGAAAGAGGAGGAAAAAGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946033320 2:216722486-216722508 AGGAACAAAGAGAAGGCAGAAGG - Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946375325 2:219304957-219304979 CTGAATAAAGTGGATTAAGAGGG - Intronic
946994366 2:225374374-225374396 GTGAAAATAGAGAAAGAAGAAGG + Intergenic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947550318 2:231040800-231040822 CTGAATAAAGATTATGAACAAGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169808390 20:9582934-9582956 CTCAAAAAATAAAAGGAAGAGGG - Intronic
1170066069 20:12311851-12311873 CTGAATATAGAGAAAGCAAATGG - Intergenic
1170795169 20:19540800-19540822 CTATATAAAGGGACGGAAGATGG - Intronic
1172572649 20:35982518-35982540 GTGGACAAAGAGATGGAAGAGGG - Intronic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173343095 20:42172071-42172093 TTGATTAAAGAGAAAAAAGAAGG + Intronic
1173966746 20:47118236-47118258 CTGAAAAGAGAGAGGGAAGGGGG - Intronic
1174672744 20:52323231-52323253 GTGAATAAAGAGAAGAAAAGAGG + Intergenic
1174763529 20:53229947-53229969 AGGAAGAAAGAGAAAGAAGAAGG + Intronic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175468348 20:59208245-59208267 CTGGATACAGAGGAGGGAGATGG - Intronic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1176136818 20:63526686-63526708 CTCAAAAAAAAAAAGGAAGAAGG + Intergenic
1177271710 21:18857247-18857269 CTGACTATAGAGAAATAAGATGG + Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177501169 21:21956952-21956974 CTGAAAAAAAAGGAGGAAAAAGG - Intergenic
1177534887 21:22412058-22412080 CTGAACAAAGAGAACAAAGCTGG - Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180838183 22:18942557-18942579 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182677796 22:32053420-32053442 CCAAAAAAAGAGAAGGATGAAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183104700 22:35607516-35607538 TGGAATAAAGAGAAGGTAGGAGG - Intronic
1183476960 22:38041015-38041037 CTCAACACAGTGAAGGAAGACGG + Intronic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1184200488 22:42965411-42965433 CTCAATAAAGAGGAAGAAGGCGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949583066 3:5410455-5410477 CTGAAAGAAGTGAAGGAATATGG + Intergenic
949768707 3:7554744-7554766 CTGATTATAGAGAAGGGAGGAGG - Intronic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
949891503 3:8736984-8737006 AAGAATAAAGAAAAGAAAGAAGG + Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950452706 3:13074137-13074159 ATGAAAAGAGAGCAGGAAGAGGG + Intergenic
950956881 3:17063304-17063326 CTAAAAAAAAAGAAGGAAGGAGG - Intronic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952759503 3:36901656-36901678 CTGAACCAAAAGAAGGTAGAGGG + Intronic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
953037307 3:39224258-39224280 TTGAATAAAGAGCTGGAAGAAGG - Intergenic
953434218 3:42865809-42865831 GTGAAGAAAGTGGAGGAAGAAGG - Exonic
953537836 3:43789495-43789517 CTGAAAAAAAAAGAGGAAGAGGG - Intergenic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
954034559 3:47844247-47844269 CTGGAGAAAGACGAGGAAGAGGG + Intronic
954494777 3:50946784-50946806 CTAAAAAGAGAGAAGGATGAAGG - Intronic
954759112 3:52861242-52861264 CTGAACAGAGAGAGGGGAGAAGG + Intronic
954759977 3:52866991-52867013 CTGCATAAAGACAGGGAAGCCGG + Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955461151 3:59184513-59184535 GTGAAAAAAAGGAAGGAAGAAGG + Intergenic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956226743 3:66968666-66968688 CTGAAGAAATATAAGGAATAGGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957474581 3:80706606-80706628 CTGAATAAAGAAAATGCAGTGGG + Intergenic
957936802 3:86954802-86954824 AAGAATAAAGGAAAGGAAGAAGG + Intronic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959836791 3:110927382-110927404 TTGAAGAAAGAAAAGGAAGGAGG + Intergenic
960027890 3:113029539-113029561 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
960307589 3:116080958-116080980 ATTAAGAAAGGGAAGGAAGAAGG + Intronic
960325855 3:116295235-116295257 CTGAATAAAAGTAAGGATGAGGG + Intronic
960735895 3:120780360-120780382 TTGAATAAAGACATGAAAGATGG + Intronic
960916619 3:122701708-122701730 CTGAAGAAAGATAAGGACCAAGG + Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961297141 3:125894177-125894199 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
961321001 3:126075549-126075571 CTGAAAAAAAAGAATGAAGTTGG + Intronic
961346623 3:126267563-126267585 GTGATTAAAGAAAAGAAAGAAGG + Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961618853 3:128207202-128207224 AGGAAGAGAGAGAAGGAAGAAGG - Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
961724404 3:128916730-128916752 CTGAACAGAGAGAAATAAGATGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962384946 3:134925368-134925390 CTGCATAATGGGGAGGAAGAAGG + Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
962560113 3:136597286-136597308 CTTAGTAAAGAAAAGAAAGAAGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
963116576 3:141735431-141735453 CTAAATAAAGGAAAGGGAGAAGG - Intergenic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963469812 3:145726231-145726253 ATGATGAAAGAGATGGAAGAGGG - Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963659178 3:148102908-148102930 CAGAAAAAAGGAAAGGAAGAAGG - Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
963979806 3:151524882-151524904 ATGATGGAAGAGAAGGAAGAAGG - Intergenic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966274108 3:178143604-178143626 CTGCAGAAAGAGAAAGAAGTGGG - Intergenic
966555448 3:181254417-181254439 GTGTATAAAGATATGGAAGAAGG + Intergenic
967026322 3:185567822-185567844 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970380179 4:15499536-15499558 CTGAATAAAGAAACTGAAGTAGG - Intronic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
970696976 4:18689745-18689767 CTGATTAAAAATAAGGAATAGGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970738219 4:19198991-19199013 CTGAAGTATGAGAAGGAAAAGGG + Intergenic
971156461 4:24088359-24088381 CTAAAAAAAAAGAAAGAAGAAGG + Intergenic
971364158 4:25963576-25963598 CTGAGTAGGGAGTAGGAAGATGG - Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
972078120 4:35112265-35112287 CTAAATTAAGACAATGAAGAAGG - Intergenic
972366345 4:38378713-38378735 CAGAATAAAGAAAATAAAGACGG + Intergenic
972409042 4:38773609-38773631 CCCAATCTAGAGAAGGAAGATGG - Exonic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973247589 4:48025926-48025948 CTGAATGAAGGGCAGGGAGAAGG - Intronic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
974800819 4:66815513-66815535 CTCAATAAAGAGAATGGAGGGGG - Intergenic
974888999 4:67855970-67855992 CTGATGAAAGAAATGGAAGAGGG + Intronic
975019751 4:69471626-69471648 ATGGATAAAGAAAAGGTAGATGG + Intergenic
975031280 4:69620691-69620713 CTAAACAAAAAGAACGAAGATGG + Intronic
975091486 4:70409542-70409564 CTAAATCGAGAGAAAGAAGATGG - Exonic
975299246 4:72770432-72770454 GTGAACAAAGGGGAGGAAGAAGG - Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975967581 4:79993264-79993286 ATAAAGAAAGAGAGGGAAGAAGG + Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976742706 4:88373502-88373524 CTGATTAAAGAAATTGAAGAGGG + Intergenic
977031057 4:91883513-91883535 ATGAATAAAAAGAAAGGAGACGG - Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977561786 4:98540335-98540357 CTCAAAAAAAAAAAGGAAGAGGG - Intronic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978386476 4:108180535-108180557 AGGAAGGAAGAGAAGGAAGAAGG + Intergenic
978466045 4:109010640-109010662 TTGGAAAAAGAGAAGGCAGAAGG + Intronic
978594057 4:110357550-110357572 CTGAGTAAAGAGCTAGAAGAGGG + Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
978857757 4:113412598-113412620 CTGAATCAAGATCTGGAAGAGGG - Intergenic
979372144 4:119901821-119901843 GTGAATAAAGTGATTGAAGAAGG - Intergenic
979548685 4:121965522-121965544 GTGAATATAAAGAAGGGAGAGGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980283264 4:130750347-130750369 CTGAATAAAATGAATGAAAATGG + Intergenic
980545027 4:134249102-134249124 CTGAAAACAGACAAGGAAAAAGG + Intergenic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
981184242 4:141782297-141782319 GTGAATAAAGCTTAGGAAGATGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982001144 4:151022378-151022400 CTGAACAAATAAAAGGAATATGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982786096 4:159538518-159538540 CTGAAGCAAGTCAAGGAAGAAGG + Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983254995 4:165388282-165388304 CTAAAAAAAGAAAAGGAAAAAGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983506082 4:168555368-168555390 CTAACTAAAAAGGAGGAAGATGG + Intronic
983656326 4:170089142-170089164 GTGACCAAAGAGAAGGCAGAGGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983893335 4:173054703-173054725 CTCAATAAAGCTAAGGCAGAGGG + Intergenic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984123310 4:175772709-175772731 ATAAATAGAGACAAGGAAGATGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984859402 4:184223496-184223518 TTGAATAAAAAGAATGAAGCTGG + Intergenic
985729017 5:1536112-1536134 CTCAATATAAAGAAGAAAGAGGG - Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987257258 5:16168751-16168773 AGGAAGAAAGAGATGGAAGAAGG + Intronic
987323906 5:16795035-16795057 GGGAAACAAGAGAAGGAAGATGG + Intronic
987615344 5:20266742-20266764 CTAAATATTGAAAAGGAAGAGGG + Intronic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988380470 5:30492207-30492229 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988452622 5:31358670-31358692 AGGAAGAAAGAGAAAGAAGATGG - Intergenic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
989189942 5:38660862-38660884 TTAAATAAAGAAAAGGAAAAGGG + Intergenic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989836924 5:46005298-46005320 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990378074 5:55193037-55193059 TTGACTAAAGGGAAGGGAGACGG - Intergenic
990540869 5:56771319-56771341 ATGAATAAAGATAAGGGATAAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991522994 5:67521496-67521518 AGGAAGAAAGAGAGGGAAGAAGG - Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
992278567 5:75148341-75148363 CTCCATAAAGAGGAGGAGGAAGG + Intronic
992378561 5:76214683-76214705 CTGATGAAAGAAATGGAAGATGG - Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993366193 5:87036512-87036534 ATGAAAAAAGAAAAGGAAGATGG - Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
994269968 5:97765126-97765148 CTGAATAAGGATAAGCAACAAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994380661 5:99067143-99067165 ATGAGTAAAGAGAAGAAAAATGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996222972 5:120954914-120954936 CTGACGAAAGAAATGGAAGATGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996684616 5:126266669-126266691 CTGGATAAAGACAATGTAGATGG - Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
996836702 5:127801600-127801622 TTGAATGAAGAGAAGAGAGAAGG - Intergenic
996872825 5:128210411-128210433 CCAAATTAAGAGAAGGAAAAAGG + Intergenic
996971356 5:129372202-129372224 TGGAATAAAGAGAAGGGAAATGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997763312 5:136472207-136472229 ATGCATAAAGAGAAGTAATAAGG + Intergenic
997990358 5:138540019-138540041 CTGAATAAAGGGAAGTATGTTGG - Intronic
998344839 5:141452731-141452753 AGGAAGAGAGAGAAGGAAGAAGG + Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999952165 5:156662980-156663002 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1000032426 5:157415171-157415193 CTGAATAAAAAGAACAAAGCTGG + Intronic
1000185084 5:158851422-158851444 GGGAAGAAAGAAAAGGAAGAAGG + Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001085025 5:168694215-168694237 CTGAATTTAGAGCAGGCAGATGG - Intronic
1001358488 5:171056900-171056922 CTGAATAAACTGTAGGAAAAAGG - Intronic
1001719413 5:173844296-173844318 CTGAAAAAAGAGAATGCTGAGGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003953696 6:11142770-11142792 ATGAATAAGGAGAAGGGAGGGGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004718558 6:18243554-18243576 GTGAACAAAGATAAGGAACAGGG - Intronic
1004875764 6:19951922-19951944 CTGAATAAAAAGAAAAAAGTTGG - Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005201630 6:23351697-23351719 CTTAAGAAAGAGAACCAAGAAGG - Intergenic
1005438385 6:25838686-25838708 CTGAATAGCAAGAAGGAACAAGG - Intronic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005759055 6:28950926-28950948 GGGAATAAAGAAAAGGAACATGG + Intergenic
1005944988 6:30589004-30589026 CTCAAAAAAGAAAAGGAACAGGG - Intronic
1006054428 6:31372487-31372509 CCCAAAAGAGAGAAGGAAGAAGG + Intergenic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007571964 6:42899282-42899304 CTCAAAAAAGAAAAGGAATAGGG - Intergenic
1007620898 6:43213787-43213809 CTGAACGTAGAGAAGGATGAAGG + Exonic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008229187 6:48963167-48963189 GGGAATTAAGAGAAAGAAGATGG - Intergenic
1009417905 6:63436145-63436167 AGGAAAAAAGAGAATGAAGATGG - Intergenic
1009483115 6:64185471-64185493 CTGATTACAGAAAAGGCAGATGG - Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1009858939 6:69299823-69299845 CTGAACAAAAAGAAGAAAGCTGG - Intronic
1009937080 6:70246532-70246554 CTAAATAAAGATAAGGAATGGGG - Intronic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010456326 6:76060151-76060173 CTGAATGAAGAAAATGAAGTCGG + Intronic
1010508450 6:76688491-76688513 CTGTATAAAAAGGAGGCAGATGG + Intergenic
1010591944 6:77722469-77722491 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011920896 6:92576764-92576786 CAGAATAAAGAAAAGCAAGGTGG + Intergenic
1012073893 6:94658510-94658532 AGGAAGAAAGAAAAGGAAGAAGG - Intergenic
1012089410 6:94873009-94873031 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1012355911 6:98314323-98314345 TTGAATAAAGGGGACGAAGAGGG - Intergenic
1012627466 6:101421371-101421393 CGGAAGAAAGAGGAGGAAGCAGG + Intronic
1012633442 6:101503349-101503371 ATGAATAGAAAGGAGGAAGAAGG + Intronic
1013247881 6:108304758-108304780 CTTCACAAAGAGAAAGAAGAGGG - Intronic
1013783285 6:113752120-113752142 CTGATGAAAGAAATGGAAGAAGG + Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1013859078 6:114611998-114612020 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1014505956 6:122256488-122256510 CTGAATACAGAGAAGCAACTAGG + Intergenic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014709217 6:124786918-124786940 CTGTATAAAGGGAAGTAACACGG - Intronic
1014931339 6:127340326-127340348 CTCAGTAAATAGAATGAAGAAGG - Intronic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015203779 6:130612427-130612449 CTGAATAGGGACAAGGAAGTTGG + Intergenic
1015217648 6:130768285-130768307 ATGAAAAGAGAGAGGGAAGAAGG - Intergenic
1015389916 6:132670087-132670109 CAAAAGGAAGAGAAGGAAGAGGG + Intergenic
1015677832 6:135770214-135770236 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1015771461 6:136772402-136772424 CTGTATACAGATAAGGCAGAAGG + Intronic
1015964393 6:138683536-138683558 CTAAACAAAGAGAAGGAAAAGGG + Intronic
1016578450 6:145599408-145599430 CAGAACAAAGAGAATAAAGAAGG - Intronic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018319339 6:162590441-162590463 CTTAATAAAAAAAAGAAAGATGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018661684 6:166093210-166093232 CTGACTAAAGAATAGGATGATGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019821330 7:3245402-3245424 CTAAAAAAAGAAAAGGAAAAAGG - Intergenic
1019976620 7:4587992-4588014 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1019977556 7:4596496-4596518 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1020589542 7:10117342-10117364 TTGAAAAAAAAGAAAGAAGAAGG - Intergenic
1020685386 7:11287361-11287383 ATGATTAGAGAGAAGGAAGAGGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1020991519 7:15202567-15202589 CTGACTAATGTGAAGGATGATGG - Intronic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1021739829 7:23675518-23675540 CTGAATAAAAAGAACAAAGGTGG - Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023130850 7:37001602-37001624 CTGAATAAATAAAAGGGAGATGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023641312 7:42261917-42261939 AAGAAGAAAGAAAAGGAAGAAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023977604 7:45042340-45042362 CTGAAAAGAGAGGAGAAAGAGGG + Intronic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024782889 7:52872731-52872753 CTGAACAAAAAGGAGAAAGATGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1028281550 7:88936032-88936054 AGGAAGAAAGAGAGGGAAGAGGG - Intronic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1029966912 7:104749883-104749905 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030319868 7:108154573-108154595 TTGAAAGAAGAGAAGGAAGTGGG + Intronic
1030580113 7:111344361-111344383 CTGAAGGAAGAAAAGGAAGCAGG - Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1031949368 7:127876148-127876170 CTGAATAATGACAATGAAGGGGG - Intronic
1031962582 7:128003415-128003437 CTGCATCAAGAGAAGGGAAAGGG - Intronic
1032123480 7:129173711-129173733 ATGAAGAAAGAGAAGGCAAAGGG + Intergenic
1032260876 7:130335911-130335933 CTACATAAAGAAAGGGAAGAAGG + Intergenic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032878693 7:136065704-136065726 ATAAATAAAGAGAAGAATGATGG + Intergenic
1032995605 7:137442757-137442779 ATGAATTAAGAAAAGGGAGAAGG - Intronic
1033828945 7:145228554-145228576 CTGCATAAAGAAAAGAAAAAAGG - Intergenic
1033890703 7:146009384-146009406 ATGAAAGAAGAGCAGGAAGATGG + Intergenic
1034022525 7:147660787-147660809 TTGCTTAAAGAGAAGTAAGATGG + Intronic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034588044 7:152113650-152113672 CGGAATAAAGAAACTGAAGATGG - Intronic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1036292166 8:7503441-7503463 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1037014485 8:13885717-13885739 TGGAATATAGAGAAGGGAGATGG + Intergenic
1037099578 8:15027770-15027792 TTAAAGAAAGAGAAGGGAGAGGG + Intronic
1037334576 8:17779804-17779826 GTGAAGGAAGAGAAGGAATAAGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038301702 8:26356387-26356409 GTGAAAACAGAGAAGGCAGAGGG - Intronic
1038438321 8:27554128-27554150 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1039240590 8:35551928-35551950 ATCAATAAAGAGAAGGGCGAAGG + Intronic
1039373064 8:37006147-37006169 TTGAATGAAGAGAGGTAAGAAGG + Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1040963283 8:53058250-53058272 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041623110 8:59996479-59996501 CTTCATAAAGTGAAGGATGATGG - Intergenic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042397825 8:68311905-68311927 AGGGAAAAAGAGAAGGAAGAAGG - Intronic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042519324 8:69694427-69694449 GTCAATAAAGAGAAAGATGAAGG - Intronic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044394507 8:91694248-91694270 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045200534 8:99975887-99975909 CTGATTAAAAAGAATGAACATGG + Intronic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1046748675 8:117903641-117903663 CTGAAGAAAAAGGAGGAAAATGG - Intronic
1046847949 8:118939645-118939667 ATGAAGAAAGAGAAGGAATTTGG + Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1047671706 8:127155073-127155095 CGGAATGGTGAGAAGGAAGATGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048075142 8:131061831-131061853 GGGAAGACAGAGAAGGAAGAAGG - Intergenic
1048161084 8:132022718-132022740 TTGATTAAAGGGAGGGAAGAAGG + Intergenic
1048251952 8:132873868-132873890 CAGAAGAAAGAGTAGGCAGAAGG + Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048551661 8:135438938-135438960 AGGAAGGAAGAGAAGGAAGAAGG + Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048927164 8:139281401-139281423 CTTCATAAAGAGGAGGCAGAAGG + Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050424245 9:5497602-5497624 TTGAACAAAGACAAGTAAGAAGG - Intergenic
1050494372 9:6225348-6225370 CTGAATAAAGAAATGGCAGCAGG + Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1050804848 9:9661764-9661786 AGGAAGAAAGAGAAGGAAAAAGG + Intronic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051129275 9:13841381-13841403 AGGAAGAAAGAAAAGGAAGAAGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1053264555 9:36701196-36701218 CTGAATAAAGGGCAAGAAGATGG + Intergenic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1054991453 9:71331869-71331891 AGGAAGAAAGAGGAGGAAGAAGG + Intronic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055358449 9:75462330-75462352 CTGAATTCAGAGAAGGCACAGGG + Intergenic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1055737463 9:79347010-79347032 CTGATTAAAGAGGGAGAAGATGG - Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1056032454 9:82567246-82567268 AGGAAGAAAGAGAGGGAAGAAGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1057461049 9:95262345-95262367 CTGAAGAAAGATAACAAAGAGGG + Intronic
1058252688 9:102719997-102720019 CTGAACAAAGTGAAATAAGAAGG - Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1058459654 9:105171117-105171139 CAGCATAGAGAGAAAGAAGATGG + Intergenic
1058561449 9:106233207-106233229 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058561462 9:106233272-106233294 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1059303168 9:113331827-113331849 CTGAAGAAAGAGAAGGCCCAGGG - Intronic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060386027 9:123229347-123229369 CTCAATAAAGAAATAGAAGAGGG + Intronic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1061723221 9:132566637-132566659 CTTTAGAAAGAGAAGGGAGATGG - Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062515917 9:136935653-136935675 CTATAAAAAGAGAAGGAAAAAGG - Intronic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1185992653 X:4909519-4909541 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1186387670 X:9126396-9126418 CTAACTAAAGACAAGGATGAAGG + Intronic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186920837 X:14278196-14278218 CTGAACAAAGAGAACGAAGCTGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187777620 X:22780274-22780296 TGGAATAAAGAAAAGAAAGAGGG + Intergenic
1187991495 X:24878480-24878502 CTGAATAAAGGCAGGGGAGAGGG + Intronic
1188773463 X:34184223-34184245 TTGATTAAAGAAAAGGAAAATGG - Intergenic
1188820895 X:34773741-34773763 CCCAATTCAGAGAAGGAAGAGGG + Intergenic
1188933500 X:36144671-36144693 CAGAACAAAGAGACAGAAGAAGG + Exonic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189627775 X:42917835-42917857 TTTATTAAAGAGAAGCAAGAGGG + Intergenic
1190177391 X:48162183-48162205 ATGAATACAGGGAAGGGAGAGGG - Intergenic
1190183424 X:48214037-48214059 ATGAATACAGGGAAGGGAGAGGG - Intronic
1190437296 X:50438100-50438122 CTTAATAAAGGGAAGGAGCAAGG + Intronic
1190658088 X:52629801-52629823 ATGAATACAGGGAAGGGAGAGGG - Intergenic
1190666510 X:52701032-52701054 ATGAATACAGGGAAGGGAGAGGG + Intronic
1190672908 X:52757378-52757400 ATGAATACAGGGAAGGGAGAGGG - Intronic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192850902 X:74954657-74954679 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193093299 X:77518486-77518508 CTGATGAAAGAAATGGAAGAGGG + Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193183116 X:78482160-78482182 GTGAAGAAAGAGAAGAAATAAGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194491538 X:94555949-94555971 CAGAATAAAAAGCAGGCAGAAGG + Intergenic
1194537426 X:95122051-95122073 CTGATTAAAGAAACTGAAGAGGG + Intergenic
1194610290 X:96035161-96035183 CTGAAGAAAGAAAGGGAAGCAGG - Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195691263 X:107627850-107627872 TTGAAACAAGTGAAGGAAGATGG - Intergenic
1195705422 X:107734686-107734708 CTGAAGCAAGTGAGGGAAGAGGG + Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1197619737 X:128734145-128734167 CTGAATGAAATGAAGCAAGAAGG + Intergenic
1197646957 X:129028095-129028117 TTGAATAAAGGGAAGGGAGAGGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199322184 X:146453276-146453298 CTCACTTAAGAGGAGGAAGAGGG - Intergenic
1199357363 X:146877070-146877092 CTGAATAAAGCAAAGGTAAATGG - Intergenic
1199888718 X:152051688-152051710 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1200772137 Y:7136007-7136029 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1201566747 Y:15373162-15373184 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic