ID: 1044892626

View in Genome Browser
Species Human (GRCh38)
Location 8:96853635-96853657
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044892625_1044892626 -7 Left 1044892625 8:96853619-96853641 CCTGTATACTTTGGCTCTGAATT 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1044892626 8:96853635-96853657 CTGAATTTACGTGTTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr