ID: 1044898452

View in Genome Browser
Species Human (GRCh38)
Location 8:96918542-96918564
Sequence CTGAGTAAACAGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044898452_1044898458 17 Left 1044898452 8:96918542-96918564 CCCAGGACCCTCTGTTTACTCAG 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1044898458 8:96918582-96918604 ATTTATGCATAGCTAGGAATAGG No data
1044898452_1044898460 25 Left 1044898452 8:96918542-96918564 CCCAGGACCCTCTGTTTACTCAG 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1044898460 8:96918590-96918612 ATAGCTAGGAATAGGGCTGCTGG No data
1044898452_1044898459 18 Left 1044898452 8:96918542-96918564 CCCAGGACCCTCTGTTTACTCAG 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1044898459 8:96918583-96918605 TTTATGCATAGCTAGGAATAGGG No data
1044898452_1044898457 11 Left 1044898452 8:96918542-96918564 CCCAGGACCCTCTGTTTACTCAG 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1044898457 8:96918576-96918598 GAGTGTATTTATGCATAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044898452 Original CRISPR CTGAGTAAACAGAGGGTCCT GGG (reversed) Intronic
900658077 1:3770020-3770042 CTGAGAGAAAGGAGGGTCCTGGG - Intronic
904847003 1:33427619-33427641 CTTAGTAAACAGAAGGTCATTGG - Intronic
907865863 1:58398483-58398505 ATGTGAAAACAGAGGGTCCTGGG - Intronic
912544827 1:110443130-110443152 CTGGGGATACAGAGGATCCTTGG + Intergenic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
913497829 1:119444673-119444695 CTGAGTAAACAATGGGTTGTGGG - Intergenic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
919932946 1:202233389-202233411 CTGAGAAAACAGGGGGTCGCAGG - Intronic
921949528 1:220915104-220915126 CTTGGTAAACAGACGGCCCTAGG + Intergenic
923406391 1:233665396-233665418 CCGAGTGAACAGAAGGTACTAGG - Intronic
924271843 1:242342057-242342079 CTGAGTAAACATACTGTCTTGGG - Intronic
924703959 1:246482898-246482920 CTGGGGAATCAGAGGCTCCTTGG - Intronic
924843425 1:247739052-247739074 CTGGCTCAACAGAGGGGCCTTGG + Exonic
1065464196 10:26001650-26001672 AGGAGAAAAGAGAGGGTCCTTGG - Intronic
1067131789 10:43571981-43572003 CTCTGTAAACTGAGGGTCTTGGG - Intronic
1070001529 10:72381611-72381633 CTGAGTACACAGGGGGTCAGCGG - Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1073480858 10:103785343-103785365 CTGACTGGACAGAGGGTCCCCGG - Intronic
1075078927 10:119369902-119369924 CTGGGTAAACGGAGGGTCAGGGG - Intronic
1075819310 10:125292068-125292090 AAGAGTAAACAGATGGTCTTTGG - Intergenic
1076232118 10:128829270-128829292 CCTAGCAAACTGAGGGTCCTGGG - Intergenic
1076267260 10:129118496-129118518 CAGAGAAACCTGAGGGTCCTGGG + Intergenic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1076696177 10:132248471-132248493 CTAGGTGGACAGAGGGTCCTTGG - Intronic
1077124987 11:929473-929495 CTGAGGAAACTGAGGCTCCGTGG - Intronic
1079153393 11:17922136-17922158 TTCAGGAAACAGAGTGTCCTTGG + Intronic
1081717522 11:45260948-45260970 CTGAGTGGACAGAGTGTCCCTGG - Intronic
1083032655 11:59607753-59607775 CTGAGTAAACAGAGCACCCATGG - Intronic
1083331363 11:61899924-61899946 CTGAGCCAACACAGGGTCCCCGG - Intronic
1084111112 11:67014740-67014762 CTGAGAACCCAGAGGGGCCTAGG + Intronic
1084975899 11:72798126-72798148 CAGAGTAAAGAGAGGGTCTGTGG - Intergenic
1085821494 11:79798541-79798563 CAGAGAAAATAGAGGGTACTTGG - Intergenic
1087149485 11:94845851-94845873 CTGAGTAAACAGACCATTCTGGG + Intronic
1087416937 11:97868838-97868860 CTGTGAAACCATAGGGTCCTGGG + Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089178093 11:116562741-116562763 CAGAGGGAACTGAGGGTCCTTGG - Intergenic
1089333062 11:117703431-117703453 GTGAGTAAACAAAGTCTCCTAGG - Intronic
1089403579 11:118179747-118179769 ATGAGGAAACAGAGGTTCATGGG + Intergenic
1089671323 11:120058825-120058847 CTGAGTGGACTGAGGGGCCTGGG + Intergenic
1090967798 11:131613870-131613892 CTGAGGAAACAGAGGAACCCTGG + Intronic
1091599484 12:1909141-1909163 TTGAGGAAACAGTGGGACCTGGG - Intronic
1092926468 12:13276773-13276795 CTGAGTAGTCAGAGGTTCCGTGG + Intergenic
1096753875 12:53782718-53782740 ATGAGTAAATAAAGGGTCTTGGG + Intergenic
1096817939 12:54213421-54213443 CTGAGGCACCAGTGGGTCCTTGG + Intergenic
1097520064 12:60656246-60656268 CTGAGTTCACAGAGGGTAATGGG - Intergenic
1097728393 12:63100076-63100098 CTGAGAAAGCAGAAGGGCCTGGG - Intergenic
1099940696 12:89184408-89184430 GTGAAGAAACAGTGGGTCCTAGG + Intergenic
1102063114 12:109950170-109950192 CCTAGTAAACAGAGGGGCATGGG + Intronic
1107013792 13:35693404-35693426 CTGAGTAAATGGAGAGACCTGGG + Intergenic
1107424050 13:40275386-40275408 ATGGGTAAACATAGAGTCCTGGG - Intergenic
1109136789 13:58661787-58661809 CTTAAAAAACTGAGGGTCCTGGG + Intergenic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1110362268 13:74641173-74641195 TGGAATAACCAGAGGGTCCTGGG - Intergenic
1113424529 13:110197220-110197242 GAGAGTCAACAGAGGGTTCTGGG - Intronic
1114714629 14:24811932-24811954 GTGAGTACACAGAGGGTTTTAGG + Exonic
1115720527 14:36156340-36156362 CTGATCAAACAGTGGGTCTTAGG + Intergenic
1117334527 14:54745502-54745524 CTGAGTATACATAGGGTTCTAGG - Intronic
1119005698 14:70925803-70925825 AGGAGGAAACAGAGGCTCCTAGG + Intronic
1121069749 14:91007104-91007126 CTGAGGGAAAAGAGGGGCCTGGG + Intronic
1121841138 14:97134865-97134887 CTGAGGAAGCAGAGGACCCTTGG - Intergenic
1122572623 14:102717403-102717425 CTGAGCACACAGAGTGTGCTTGG - Intronic
1124045904 15:26149500-26149522 CTGAGCAGCCAGGGGGTCCTGGG + Intergenic
1125177829 15:36845547-36845569 ATGAGAAAACACTGGGTCCTAGG + Intergenic
1127574701 15:60279594-60279616 CTGAGGAAGCAGAGAGTGCTAGG - Intergenic
1128387592 15:67161819-67161841 ATGAGAAAACTGAGTGTCCTAGG + Intronic
1129190188 15:73932889-73932911 CTGTGGAAACGGAGGGTTCTGGG + Intronic
1129534818 15:76304384-76304406 ATGAGTAAACCGTGTGTCCTGGG - Intronic
1132481343 16:167642-167664 CTGAGGAAAGAGTGGGACCTTGG + Intergenic
1135785438 16:25344764-25344786 CTGAGTAGACAGAGGTGTCTGGG + Intergenic
1137286015 16:47016557-47016579 CTTAGTCAACTGGGGGTCCTGGG - Intergenic
1137908438 16:52350860-52350882 CTTGGTAAACAAAGGGTCATTGG - Intergenic
1138228999 16:55324256-55324278 CTGAGTGAACAGAGGCGCGTGGG - Exonic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1143299429 17:5898711-5898733 CTGAGTGAAATGGGGGTCCTAGG + Intronic
1143749813 17:9020578-9020600 ATGAGGAAACTGAGGGTCCCGGG - Intergenic
1144756876 17:17685270-17685292 CTTTGGAAACAGTGGGTCCTTGG - Intronic
1146981838 17:37169999-37170021 CTGACTAAACAAGTGGTCCTAGG + Intronic
1147337579 17:39736916-39736938 CTGGGCAAACACAGGGTACTTGG - Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1148174216 17:45550056-45550078 CTGAGGAAGCAGAGGGCCCCAGG + Intergenic
1148275046 17:46295391-46295413 CTGAGGAAGCAGAGGGCCCCAGG - Exonic
1148297153 17:46512970-46512992 CTGAGGAAGCAGAGGGCCCCAGG - Exonic
1148361709 17:47017450-47017472 CTGAGGAAGCAGAGGGCCCCAGG - Intronic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1150405434 17:64896978-64897000 CTGAGGAAGCAGAGGGCCCCAGG + Exonic
1150432208 17:65127434-65127456 TGGAGCAAACAGAGGGTCCTGGG + Intergenic
1150900288 17:69267430-69267452 CTAAGTATACAGAGGTTCTTTGG - Intronic
1150989018 17:70233326-70233348 CTGAGTAAAGAAAAGATCCTGGG + Intergenic
1151542351 17:74771011-74771033 CTGAGGAAGCAGAGGCCCCTTGG - Exonic
1153223664 18:2882120-2882142 GTGAGAAAACAGAGGCTCATGGG - Intronic
1153550433 18:6256924-6256946 CTGAATAAACAGGGGGTCGGTGG + Intronic
1160109270 18:76010111-76010133 CTTATTAAATAGAGGGTGCTGGG - Intergenic
1161048691 19:2150906-2150928 GAGAGTAAACTGAGGGTCCAGGG + Intronic
1161532047 19:4795635-4795657 GTGAGTGAACAGAGAGCCCTAGG + Exonic
1161870785 19:6868144-6868166 CTGAGAAGATAGAGGGTTCTGGG - Intergenic
1161873269 19:6887002-6887024 CTCTGGAATCAGAGGGTCCTGGG + Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163221911 19:15927789-15927811 GGGAGTAGACAGAGTGTCCTAGG - Intronic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1166781632 19:45346323-45346345 TTCAGTAAACTGTGGGTCCTAGG + Intronic
1167916510 19:52744274-52744296 CTGAGGGGACAGAGAGTCCTAGG + Intergenic
1167921933 19:52789183-52789205 CTGAGTGGCCAGAGAGTCCTAGG + Intronic
925350240 2:3196160-3196182 CTGAGTTTTCAGAGGGGCCTTGG + Intronic
926152153 2:10431274-10431296 CTGAGTAAATACAGGGTAATGGG + Intergenic
929876859 2:45804040-45804062 CTTACTAGACAGAGGGTCCTGGG + Intronic
930924515 2:56800583-56800605 GTATGTAAACAGAGAGTCCTAGG + Intergenic
931447877 2:62342016-62342038 CTCAGGAAGCAGAGGCTCCTGGG - Intergenic
934052037 2:88219260-88219282 CTGAGGAAACTCAGGTTCCTTGG - Intergenic
935281704 2:101523340-101523362 CTCAGAGAACTGAGGGTCCTGGG + Intergenic
936161504 2:110087053-110087075 TTGAGCACACAGAGGGTCCTTGG + Intronic
936183159 2:110284301-110284323 TTGAGCACACAGAGGGTCCTTGG - Intergenic
939027638 2:137032999-137033021 CTTATTAAACAGAGGATACTGGG + Intronic
941161805 2:162044063-162044085 ATCAGTAAACAGAGGTTTCTGGG - Intronic
941831311 2:169963152-169963174 CTGACTAAACAGAGCATCCAGGG - Intronic
947124779 2:226856077-226856099 ATTAGTAAACAGGGAGTCCTGGG - Intronic
947589729 2:231378776-231378798 CTCAGTAAACCCAGGGTCCCTGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
949031594 2:241799767-241799789 GTGAGCAAAGACAGGGTCCTTGG - Intronic
1169197728 20:3692502-3692524 CTCTGTGAGCAGAGGGTCCTTGG - Exonic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1171193236 20:23176560-23176582 CTAAAAAAACTGAGGGTCCTGGG - Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1173337410 20:42124060-42124082 CTGAGTAAAGAGACCCTCCTTGG + Intronic
1173338712 20:42135214-42135236 CTGGGTAAACAGAGGCTCAGGGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1174065798 20:47864927-47864949 TTGAGTGAACAGAGCATCCTGGG + Intergenic
1174188149 20:48721643-48721665 CGGAGTGAGCAGAGAGTCCTGGG + Intronic
1174267076 20:49339798-49339820 CTGAGGAGAGAGAGGCTCCTAGG + Intergenic
1175250938 20:57609919-57609941 CTAAGGAGACAGAGGCTCCTGGG + Intronic
1176430829 21:6574554-6574576 CTGAGTCCACAGACGCTCCTCGG + Intergenic
1179706223 21:43182016-43182038 CTGAGTCCACAGACGCTCCTCGG + Intergenic
1181616143 22:24055816-24055838 CTGAGTGCTCAGAGGGTACTGGG + Intronic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
949461639 3:4301186-4301208 CTGAGCAGACAGACAGTCCTGGG + Intronic
949509895 3:4758624-4758646 CTGTGTAAACAAGTGGTCCTGGG - Intronic
950609469 3:14116726-14116748 CTGAAGAAAAAGAGTGTCCTGGG + Intronic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
954710016 3:52501025-52501047 CAGAGTAAGCAGAGGGTTCTGGG - Intronic
955835876 3:63054523-63054545 CCGAGAAAACTGAGGATCCTAGG + Intergenic
956210324 3:66795687-66795709 CTGGGTAATCTGAGGCTCCTGGG + Intergenic
961565350 3:127759763-127759785 CTCACTCAACACAGGGTCCTTGG + Intronic
962879463 3:139562525-139562547 CTGAGTAAAGAGAGGCTCCAGGG + Intronic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
967671809 3:192245416-192245438 CTGAGTAAACAGTAAGTCCTTGG - Intronic
967948468 3:194822588-194822610 CTGAGGAAGCTGAGGGACCTGGG - Intergenic
970353811 4:15232780-15232802 CTTAGTACACAGTGGGTGCTAGG - Intergenic
971192085 4:24437405-24437427 CTGAGGGAACGGGGGGTCCTAGG + Intergenic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
972436017 4:39036172-39036194 CTGAGTATGGAGAGGGTCCCCGG + Intergenic
973330367 4:48906237-48906259 CTGAGGAAACAGAGGGTCCCCGG - Intronic
973841246 4:54863169-54863191 CTTAGTAATCAGAGAGACCTGGG + Intergenic
976649960 4:87423555-87423577 GTTAGTAAACACAGGGTCCTAGG + Intronic
988363647 5:30267851-30267873 TTTAGAAAACAGAGGGTCCCAGG + Intergenic
990614573 5:57494556-57494578 CTGAGGAAACAGAGCCTCCATGG + Intergenic
991402909 5:66272894-66272916 CTGAGAAAACAGAGGCTCAGAGG + Intergenic
992207559 5:74445715-74445737 CTGACTGAACAGCAGGTCCTGGG + Intergenic
994101038 5:95892978-95893000 CGGGGTAAAAAGAGGTTCCTGGG + Intronic
994109191 5:95981156-95981178 CAGAGTATACACAGGGTGCTTGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996475281 5:123911970-123911992 GTGAGTAAATAAATGGTCCTTGG + Intergenic
996510490 5:124310467-124310489 CTGAGCAAACTGAGGAGCCTTGG - Intergenic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
1001046035 5:168372499-168372521 CTCAGTAAACAGAGGCTATTAGG - Intronic
1002029152 5:176415748-176415770 CTGGGAAAAAAGAGGATCCTGGG - Intronic
1002116883 5:176969206-176969228 CTGAGGAAAGAGAGGAGCCTTGG - Exonic
1003503645 6:6722964-6722986 AAAAGTAAACAGAGGGCCCTGGG - Intergenic
1004260398 6:14102777-14102799 CTGAGCAATCGGAGGGTCCTGGG - Intergenic
1006501220 6:34460187-34460209 CTGAGGAAACTGAGGCTCATTGG - Intergenic
1007401610 6:41605739-41605761 CTGAGTAGTCAGGGAGTCCTAGG - Intergenic
1011480656 6:87790409-87790431 CTCAGTAAACAAAGAGACCTTGG + Intergenic
1011773898 6:90706997-90707019 GTGGGTAAGCAGAGTGTCCTGGG - Intergenic
1016349458 6:143151612-143151634 CTAACAAAACAGAGTGTCCTGGG - Intronic
1017168442 6:151432536-151432558 CTGAGGAAACTGAGGGTCATAGG - Intronic
1017599624 6:156066647-156066669 CTGAGTAGACATGGGGTCCCAGG - Intergenic
1018432670 6:163735250-163735272 CTGAGTAGGCACAGGGACCTCGG - Intergenic
1020712533 7:11626145-11626167 TTAAATAAAAAGAGGGTCCTAGG - Intronic
1023158239 7:37273267-37273289 ATGTGTTAACAGAGGGACCTTGG + Intronic
1023649297 7:42351828-42351850 CTGAATAAAAAGATGGTTCTGGG + Intergenic
1025741319 7:64198663-64198685 CTGTGAAAACATATGGTCCTGGG + Intronic
1033555674 7:142486853-142486875 TTCAGTAGACAGAGGGACCTGGG + Intergenic
1033892785 7:146035961-146035983 CTGAGCTAACAGAGGGTCAAGGG - Intergenic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1035156238 7:156915632-156915654 GTGAGAAAACTGAGGCTCCTGGG + Intergenic
1037362820 8:18091855-18091877 CTTAAAAAAAAGAGGGTCCTGGG + Intergenic
1037491705 8:19402468-19402490 CTGAGAAAACAGTGAGTCTTGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044311450 8:90697602-90697624 CTATGTAAACACAGGGTGCTGGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1048572641 8:135668114-135668136 CTGAGAAAACAGAGGCTCAGAGG - Intergenic
1048622188 8:136146059-136146081 TAGAGTAGCCAGAGGGTCCTGGG + Intergenic
1049016170 8:139921717-139921739 CTGAGTGGACAGAGGGGCCGGGG + Intronic
1052403156 9:28026149-28026171 CAGAATAAACAGAAGTTCCTGGG - Intronic
1053101484 9:35375452-35375474 CTAAGAAAACAGAAGGTACTAGG - Intronic
1053352702 9:37424119-37424141 CTCAGTACAAAGTGGGTCCTTGG - Intronic
1055606098 9:77972335-77972357 GTGAGTAAAAAGAGGGACCCAGG + Intronic
1056257895 9:84819048-84819070 CTCAGTAAACACAGGCTCCAGGG - Intronic
1058331352 9:103764842-103764864 CTTAAAAAACTGAGGGTCCTGGG + Intergenic
1058961969 9:109999881-109999903 CTAAGTACACAGGGGATCCTGGG - Intronic
1060441087 9:123639945-123639967 ATGAGGAAACTGAGGCTCCTGGG + Intronic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061477982 9:130881706-130881728 CTGGGTTCACAGAGGATCCTGGG + Intronic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1188830591 X:34891912-34891934 TTGAGTAAACTAAGGGTACTAGG - Intergenic
1189369578 X:40417090-40417112 CTGAGCAAACAGAGGTTCCCTGG + Intergenic
1191712969 X:64172062-64172084 CTGAGTATACAGACATTCCTAGG - Intergenic
1192726496 X:73758728-73758750 ATCAGGAAGCAGAGGGTCCTTGG - Intergenic
1194031687 X:88824797-88824819 CTGAGTATACACAAGGTCCTAGG + Intergenic
1195111708 X:101656995-101657017 CTGAGGTGACCGAGGGTCCTGGG - Exonic
1196862289 X:120039673-120039695 CTGAGGAAAGAGATGGTCGTTGG + Intergenic
1196880813 X:120196671-120196693 CTGAGGAAAGAGATGGTCGTTGG - Intergenic
1197044073 X:121975304-121975326 CAGAGTAAACTGATGGTCCTTGG + Intergenic
1197181466 X:123541408-123541430 AGGAGTAAAAAGAGGGTCATTGG + Intergenic
1197282794 X:124556736-124556758 CTGATATAACTGAGGGTCCTGGG - Intronic