ID: 1044903562

View in Genome Browser
Species Human (GRCh38)
Location 8:96974712-96974734
Sequence ATGTATTTACATGGTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1760
Summary {0: 1, 1: 33, 2: 425, 3: 489, 4: 812}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044903562_1044903567 13 Left 1044903562 8:96974712-96974734 CCCTTAAAACCATGTAAATACAT 0: 1
1: 33
2: 425
3: 489
4: 812
Right 1044903567 8:96974748-96974770 TCTGTTCTTGAATGATCATTGGG No data
1044903562_1044903566 12 Left 1044903562 8:96974712-96974734 CCCTTAAAACCATGTAAATACAT 0: 1
1: 33
2: 425
3: 489
4: 812
Right 1044903566 8:96974747-96974769 ATCTGTTCTTGAATGATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044903562 Original CRISPR ATGTATTTACATGGTTTTAA GGG (reversed) Intronic
900699584 1:4036810-4036832 ATGTATTTGCAGGGTTTTGAGGG - Intergenic
901869299 1:12128154-12128176 ATCTATTCACATGGTCTTCACGG + Intronic
902069052 1:13717178-13717200 ATTTATTGACATGCTTTTGAAGG + Intronic
902968223 1:20027607-20027629 ATATATTTGCATGGTTTTGAGGG + Intergenic
904572256 1:31475111-31475133 ATGTATTCGCATGGTTTTGAAGG + Intergenic
904843578 1:33390793-33390815 TAGTATTTACATTTTTTTAATGG - Intronic
905058341 1:35118298-35118320 ATATATTTTCATTCTTTTAATGG + Intergenic
905260627 1:36715699-36715721 ATGTGTTGACATGGTTTGGAAGG - Intergenic
905497654 1:38406107-38406129 ATATATTTGCATGGTTTTGAGGG - Intergenic
905510474 1:38515493-38515515 ATGTGTTTGCATGGTTTTGAAGG + Intergenic
906053728 1:42897569-42897591 ATGTATTTGCATGGTTTTGAAGG + Intergenic
906563764 1:46781229-46781251 ATATATTTACATGGTTTTGAAGG + Intronic
906594741 1:47065380-47065402 ATGTATTTTCATGATTTTGAGGG - Intergenic
906718624 1:47989061-47989083 GTGTATTTACATGGTGGAAAGGG - Intronic
906914881 1:49997905-49997927 ATGTATTTTCATGGTTTTTGAGG - Intronic
907001455 1:50863212-50863234 ATGTATTTGCATGGTTTTGAGGG - Intronic
907010541 1:50959338-50959360 GTGTATTTATATTGTATTAAGGG - Intronic
907349391 1:53813975-53813997 ATGTATTTGCATGGTTCTGAAGG - Intronic
907502985 1:54896664-54896686 AAGTATTTACATGAAATTAATGG - Intergenic
908174860 1:61545283-61545305 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908649155 1:66313205-66313227 ATGCATTGGCACGGTTTTAAAGG - Intronic
908803399 1:67904422-67904444 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908862172 1:68501463-68501485 ATGTATTTACATGGTTTTGAAGG - Intergenic
908890555 1:68842782-68842804 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908982028 1:69969978-69970000 ATGTATTTGCATGGTTTTGAAGG - Intronic
909098555 1:71321092-71321114 ATATATTTGCATGGTTCTGAAGG - Intergenic
909349923 1:74639679-74639701 ATGATTTTCCATCGTTTTAATGG + Intronic
909511127 1:76453570-76453592 ATGTATTTGCGTGGTTCTGAGGG + Intronic
909639562 1:77857168-77857190 ATGTATTTGCATGGTTTTGAAGG + Intronic
909830473 1:80182941-80182963 ATCTATTTGCATAGTTTTGAAGG + Intergenic
909875003 1:80790832-80790854 ATGTTATTTCATGGTTTTTATGG - Intergenic
910016186 1:82527326-82527348 ATGTATGTGCATGGTCTTGAAGG + Intergenic
910077892 1:83301691-83301713 ATGTATTTACATGGTTTTGAAGG - Intergenic
910142048 1:84037074-84037096 ATGTATTTGCATGGTTTTGAAGG + Intergenic
910199566 1:84685102-84685124 ATGTATTTAAAGCATTTTAAAGG - Intronic
910323709 1:85979037-85979059 ATGTGTTTGTATGGTTTTGAGGG - Intronic
910670126 1:89763858-89763880 ATGTCTTTACAGGGTTGTCATGG + Intronic
910919933 1:92333835-92333857 ATGTTATTACAAAGTTTTAAGGG + Intronic
911080953 1:93930076-93930098 ATGTATTTGCATGGTTTTGATGG - Intergenic
911091583 1:94021713-94021735 GTTTGTTTACATGGTTTTTAGGG - Exonic
911265659 1:95740402-95740424 ATGTATTTGCATGGTTTTGAGGG + Intergenic
911318098 1:96378994-96379016 ATGTATTTACATGGTTTTGAAGG - Intergenic
911322478 1:96431948-96431970 ATGTGTTTGCCTGGTTTTGAGGG + Intergenic
911562266 1:99420449-99420471 ATGTATTTGCATGGTTTTGAGGG - Intergenic
911679061 1:100692880-100692902 ATGTATTTGTATAGTTTTGAGGG + Intergenic
911689379 1:100814863-100814885 ATGTATTTGCATGATTTTGAAGG - Intergenic
911743497 1:101413439-101413461 ATGTATTTGCATGGTTTTGAGGG - Intergenic
912028595 1:105209635-105209657 ATGTATTTTTATAGTTTTAGGGG - Intergenic
912081478 1:105942806-105942828 ATGTATTTGCATGGTTTTGAAGG + Intergenic
912483943 1:110008929-110008951 ATGTGATTACATGGCTTTTAGGG + Intronic
912601396 1:110937427-110937449 ATGTATTTGTATAGTTTTCAAGG - Intergenic
912611966 1:111057056-111057078 ATGTATTTCCATGGTTTTGAAGG + Intergenic
913143369 1:115964278-115964300 ATGTATTTGTATGGTTTCGAAGG - Intergenic
913151595 1:116049447-116049469 ATGTATTTGCGTGGGTTTGAAGG - Intronic
913312774 1:117519034-117519056 ATGTATTTGCATGGTTTTGAAGG - Intronic
913337978 1:117727314-117727336 AGGTATTTGCATGGTTTTGAAGG - Intergenic
913339506 1:117744680-117744702 GTGTATTTGCATGATTTTGAAGG + Intergenic
913383632 1:118236040-118236062 ATGCATTTGCATGGTTTTGAGGG - Intergenic
913429241 1:118771633-118771655 ATGTATTTGTATAGTTTTGAGGG - Intergenic
913463976 1:119119758-119119780 ATGTATTTGTATAGTTTTGAGGG - Intronic
913493751 1:119407581-119407603 ATGTAGTTGCTTGGTTTTGAAGG - Intergenic
914346306 1:146801849-146801871 ATGTATTTGCATGGCTTTGAAGG - Intergenic
914455244 1:147830461-147830483 ATGTATTTGCATGGTTTTGAAGG + Intergenic
914736013 1:150417443-150417465 ATGTAATTACATGGATGGAAGGG - Intronic
914907330 1:151757274-151757296 AGGTATTTAAATGCTTTTTAAGG + Intergenic
914968210 1:152280387-152280409 ATGTATTTGCACGGTTTTGAAGG - Intergenic
915999711 1:160603501-160603523 ATATATTTGCATAGTTTTGAGGG + Intergenic
916158121 1:161878434-161878456 ATGGATTTACATGGGAATAATGG + Intronic
916313299 1:163420257-163420279 ATATAGTTACAAGTTTTTAAAGG + Intergenic
916331468 1:163622434-163622456 ATGTATTTGCATTGTTTTGAAGG + Intergenic
916380495 1:164205368-164205390 ATATTTTTACATTTTTTTAAAGG - Intergenic
916566128 1:165979896-165979918 ATGTATTTGCATGGTTTTGAGGG + Intergenic
916580165 1:166100108-166100130 ATGTATTTGGATGGTTTTGAAGG - Intronic
916872925 1:168937125-168937147 ATGTATTTGCATGGTTTTGAAGG + Intergenic
916903005 1:169250766-169250788 ATGTATTTGTATAGTTTTGAGGG + Intronic
917057665 1:171001537-171001559 ATGTATTTGTGTGGTTTTGAAGG + Intronic
917319232 1:173761584-173761606 ATGTATTTGCATGGTTTTGAAGG - Intronic
917641163 1:176984383-176984405 TTGTTTTTAGATGGTTCTAATGG - Intronic
917898228 1:179514362-179514384 ATGTATTTGCATGGTCTTGAAGG + Intronic
917907751 1:179604667-179604689 ATGTATTTGCATGGTTTTTAAGG + Intronic
918158591 1:181875125-181875147 ATGTATTTGCATGGTTTTGAGGG - Intergenic
918721600 1:187859086-187859108 ATGTATTTGCATGGTTTTGAAGG + Intergenic
919073193 1:192782011-192782033 ATGTATTTGCATGGTTTTGAAGG + Intergenic
919115269 1:193273756-193273778 ATGTATTTGCATAGTTTTGAAGG + Intergenic
919160405 1:193822695-193822717 ACATATTTGCATGGTTTTGAGGG - Intergenic
919281296 1:195493033-195493055 ATGTATTTGCATAGTTTTGAAGG + Intergenic
919492042 1:198216280-198216302 ATGTATTTATACAGTTTTGATGG - Intronic
919549249 1:198964163-198964185 ATGTATTTGCATGGTTTTGAAGG + Intergenic
919571637 1:199256312-199256334 ATGTATTTGCATGATTTTGAGGG + Intergenic
919607799 1:199707249-199707271 ATTTATTTTAATGGTTTGAAGGG + Intergenic
919721989 1:200847594-200847616 ATTTTTTTACATGATTTCAATGG + Intronic
920009209 1:202855582-202855604 AAATATTTGCTTGGTTTTAATGG + Intergenic
920132555 1:203743885-203743907 ATGTATTTATATGGTTCTTAGGG + Exonic
920323474 1:205142822-205142844 ATGTTTTTTCTTTGTTTTAAAGG - Exonic
920990060 1:210928414-210928436 ATGTATTTGGATTGTTTTGAGGG - Intronic
921000997 1:211042818-211042840 ATGTATTTGCATGGCTTTGAAGG - Intronic
921532661 1:216304809-216304831 ATGTATTTGCATGGTTTTGAGGG + Intronic
921578458 1:216866216-216866238 ATGTATGTACATGGCTTGTATGG - Intronic
921612195 1:217225790-217225812 ATTTATTAACATAGTTTTAGAGG + Intergenic
921632188 1:217448176-217448198 AAGTATATGCATGGTTTTATGGG - Intronic
921690434 1:218142549-218142571 ATGTATTTGCATTGTTTTGAGGG - Intergenic
921834750 1:219766581-219766603 ATGCATTTGCATGGTTTTGAAGG - Intronic
921843121 1:219849670-219849692 ATGTATTTGTATAGTTTTGAGGG - Intronic
921999890 1:221466311-221466333 ATGTATTTGCATGGTTCTGAGGG + Intergenic
922006452 1:221535278-221535300 ATGTATTTACATTCTTGTACAGG + Intergenic
922395775 1:225199628-225199650 ATGTATTTGCATGGTTTTGAAGG + Intronic
922658115 1:227403567-227403589 ATGTATTTGCATGGTTTCGAAGG - Intergenic
922927122 1:229358706-229358728 GTATATTTGCATGGTTTTGAAGG + Intergenic
922989463 1:229894078-229894100 TTATAGGTACATGGTTTTAATGG + Intergenic
923661919 1:235964929-235964951 ATGTATTTGCATGGTTTTGAAGG - Intergenic
923691703 1:236200140-236200162 ATGCATTTATATAGTTTTGAGGG + Intronic
923808419 1:237286312-237286334 ATGTATTTGCATGGTTTTGAAGG + Intronic
923960889 1:239082472-239082494 ATATATTTGCATGGTTTTGAAGG + Intergenic
924166208 1:241285870-241285892 AAGTATATACCTAGTTTTAAAGG + Intronic
924691775 1:246358662-246358684 ATATATTTGCATGGTTTTGAGGG - Intronic
924845116 1:247759872-247759894 ATGTATTTGCATGCCTTTGAGGG + Intergenic
924885165 1:248207599-248207621 ATGTATTTGCAAGGTTTTGAGGG + Intergenic
1063328401 10:5129128-5129150 ATGTATTTGTATAGTTTTGAGGG - Intronic
1063334727 10:5200369-5200391 ATGTATGCACATGTGTTTAATGG + Intronic
1063561062 10:7128122-7128144 ATGTGTTTTCATGGTTTTGAGGG + Intergenic
1063566572 10:7176580-7176602 CTGAATTTGCATGGTTTTCAAGG - Intronic
1063757195 10:9026297-9026319 ATTTACCTACATTGTTTTAAAGG + Intergenic
1064062593 10:12151127-12151149 ATTTATCTAAATGGTTTTTAAGG - Intronic
1064556983 10:16557015-16557037 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1064907900 10:20367794-20367816 ATGTATTTGCATGGTGTTGAAGG + Intergenic
1065418318 10:25513811-25513833 ATGTATTTGCATGGCTTTGGGGG + Intronic
1065462634 10:25984750-25984772 ATGTATTTGCATGATTTTGAGGG - Intronic
1065470714 10:26078799-26078821 ATGTATTTGCATGATTTTGAAGG + Intronic
1065598760 10:27346933-27346955 TTGTGTTTACATTGTTTTTATGG - Intergenic
1066145289 10:32551690-32551712 ATGTATTTGCATGGTTTTGAAGG + Intronic
1066170583 10:32839851-32839873 ATATATTTGCATGATTTTTAGGG - Intronic
1066352956 10:34654106-34654128 ATGTAATTGCATGGTTCTAATGG + Intronic
1066651272 10:37657664-37657686 ATGTATTTGCGTGGTTTTGAGGG - Intergenic
1067034771 10:42905364-42905386 GTGTATTTGCATGGTTTTGAGGG - Intergenic
1067233984 10:44432350-44432372 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1067655021 10:48185287-48185309 ATGTTGTTACATGGTATTAGGGG + Intronic
1068011151 10:51453600-51453622 ATGTATTTGTATAGTTTTGAGGG + Intronic
1068099062 10:52529189-52529211 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1068122623 10:52798949-52798971 ATGTATTTGCATAGTTTTCAGGG + Intergenic
1068157187 10:53215215-53215237 ATGTATTTGGATGGATTTGAGGG + Intergenic
1068161867 10:53274760-53274782 ATGTATTCGCATGGTTTTGAGGG - Intergenic
1068172839 10:53418643-53418665 ATGTATTTGCATGGTTTTGCGGG + Intergenic
1068336786 10:55643437-55643459 GTCTATTTACATGCTTTTACAGG + Intergenic
1068808739 10:61230550-61230572 GTGTATATGCATGGTTTTGAGGG - Intergenic
1068855388 10:61792524-61792546 ATTTATTTACATAATTTTAAGGG + Intergenic
1068924747 10:62524327-62524349 ACGTATTTTCATGGTTTTGAGGG + Intronic
1068928063 10:62560241-62560263 ATGTTTGTACATGATTTTCAGGG + Intronic
1069113160 10:64471306-64471328 ATGTATTTGCATGGTATTGAAGG - Intergenic
1069236985 10:66088423-66088445 ATTTATCTACATGTTATTAATGG + Intronic
1069242468 10:66160473-66160495 ATATATTTGCATGGCTTTGAAGG + Intronic
1069275312 10:66583972-66583994 ATGTATTTGCATAGTTTTGAGGG + Intronic
1069325574 10:67227895-67227917 ATGTGTTTGCATGGTTTTGAAGG - Intronic
1069648407 10:70022385-70022407 ATGTATTTGCATGATTTTGAGGG - Intergenic
1070465134 10:76714180-76714202 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1070517097 10:77218304-77218326 ATGGTTTTAAATGGTTTAAATGG - Intronic
1071015602 10:80994019-80994041 ATGTATTTGCGTGGTTTTGAAGG + Intergenic
1071023957 10:81090503-81090525 ATGTATTTGCATGATTTTGAGGG + Intergenic
1071062791 10:81592696-81592718 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1071062898 10:81594588-81594610 ATGCATTTGCACGGTTTTGAGGG - Intergenic
1071405585 10:85327630-85327652 ATGCATTTGCATGGTTTTGAAGG + Intergenic
1071435166 10:85642190-85642212 ATTTATTTACATGCTGTTTATGG - Intronic
1071484913 10:86093079-86093101 ATGGATTTGCATGGTTTTGAAGG - Intronic
1071812095 10:89193873-89193895 ATGTATTAGCATGGTTTTGGAGG + Intergenic
1071910883 10:90231674-90231696 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1071932852 10:90493027-90493049 ATGTAATTGCATGGTTTTGAGGG - Intergenic
1072885562 10:99269826-99269848 ACATATTTGCATGGTTTTGAGGG - Intergenic
1072928263 10:99636321-99636343 ATATATTTGCATGGTTTTGAAGG - Intergenic
1072935192 10:99705290-99705312 ATGTTAGTACATGATTTTAAAGG + Exonic
1073682668 10:105721156-105721178 ATGTATATATTTGTTTTTAAAGG - Intergenic
1073820461 10:107256976-107256998 GTATATTTGCATGGTTTTGAGGG - Intergenic
1073900242 10:108212708-108212730 ACATATTTGCATGGTTTTGAAGG + Intergenic
1074037114 10:109751270-109751292 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1074262958 10:111872241-111872263 ACGTTTTTACATGCTTTTATGGG + Intergenic
1074635457 10:115311100-115311122 ATGTATTTACATAGTTTTGAAGG + Intronic
1074985581 10:118656352-118656374 ATATATTTGCATGGTTTTGAAGG + Intergenic
1074985984 10:118659893-118659915 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1075157865 10:119994710-119994732 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1075889452 10:125933925-125933947 GTGTATTTGCATTGTTTTGAAGG + Intronic
1075947040 10:126442858-126442880 ATGTATTTTCATGGTTTTAAAGG - Intronic
1075982510 10:126753155-126753177 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1077775030 11:5261201-5261223 CTGTATTTGCATGGTTTTGAAGG - Intronic
1077834003 11:5907885-5907907 ATGCATTTGCATGGTTTTGGGGG + Intronic
1077964109 11:7109290-7109312 ATGTATTTGTATAGTTTTGATGG + Intergenic
1078191172 11:9093295-9093317 ATGTATTTATATGCTTTAACTGG - Intronic
1078411719 11:11127062-11127084 ATGTATTTATATAGTTTTAAGGG + Intergenic
1078472520 11:11602942-11602964 ATTCATTTACATGGTTTCTAGGG + Intronic
1078498033 11:11840624-11840646 ATTTTTGTACTTGGTTTTAATGG - Intergenic
1078919182 11:15811506-15811528 AGGTAGTTGCATGTTTTTAAGGG + Intergenic
1079207816 11:18432256-18432278 ATGTATTTGCATGGTTTTGAAGG + Intronic
1079273419 11:19010850-19010872 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1079634170 11:22714713-22714735 ATGTATTTGTATAGCTTTAAGGG - Intronic
1079656403 11:22991424-22991446 ATGTATGTAAATCTTTTTAAAGG - Intergenic
1079704843 11:23601627-23601649 ATGTATTTGCATGGTTTTAGGGG + Intergenic
1079791442 11:24745001-24745023 ATGTATTTGCATGGTTTTGAAGG + Intronic
1079850202 11:25523405-25523427 ATGCATCTGCATTGTTTTAATGG + Intergenic
1079856153 11:25608074-25608096 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1079951938 11:26816797-26816819 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1079956442 11:26871883-26871905 ATGTATTTTTATAGTTTTAAGGG - Intergenic
1080152790 11:29073826-29073848 GTGTATTTTCATGGTTTTGAAGG + Intergenic
1080203120 11:29697073-29697095 ATGTGTTTGCATGGTTTTGAGGG + Intergenic
1080369386 11:31617224-31617246 ATGTATTTCCATCATTTTTAAGG - Intronic
1080402539 11:31949721-31949743 ATGTATTTGCATGGTTTTGAAGG - Intronic
1080486265 11:32710477-32710499 ATGTACTTGTATGGTTTTGAGGG + Intronic
1080589167 11:33706425-33706447 ATGGATTTACAAGGTTGTTAAGG - Intronic
1080672304 11:34392345-34392367 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1080728519 11:34921803-34921825 ATATGTTTACCTTGTTTTAAAGG + Intronic
1080863852 11:36175601-36175623 ATGTATTTGCATGGTTTTAAGGG + Intronic
1081054854 11:38397041-38397063 TTTTATTAACATGGTTTAAAGGG + Intergenic
1081319530 11:41674386-41674408 ATATATATAAATGGTCTTAAGGG - Intergenic
1081326457 11:41751522-41751544 ATATATTTGCATAGTTTTGAGGG + Intergenic
1081565849 11:44260667-44260689 ATGTAGTTACATGGTGGTATAGG + Exonic
1082120640 11:48376052-48376074 ATGTACTTGCCTGGTTTTGAGGG + Intergenic
1082206833 11:49446652-49446674 ATGTATTTGTCTAGTTTTAAAGG - Intergenic
1082253182 11:50004587-50004609 ATGTATTTGCCTGGTTTTGAGGG - Intergenic
1082567443 11:54697941-54697963 ATGCATTTGCATGGTTTCAAAGG + Intergenic
1082682001 11:56185630-56185652 ATTTATTTAAATAATTTTAATGG + Intergenic
1082712288 11:56567539-56567561 ATGTGTTTTAATGGTTTTAGGGG + Intergenic
1082891994 11:58149483-58149505 GTGTACTTACATGGTTAAAATGG - Intronic
1083005557 11:59342196-59342218 ATGTATTTGCATGCTTTTGAGGG + Intergenic
1083127077 11:60580697-60580719 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1084220761 11:67676305-67676327 AGTTATTTGCATGGTTTTGAAGG - Intronic
1084499821 11:69528911-69528933 ATATATATATATGGTGTTAATGG + Intergenic
1085240302 11:75047739-75047761 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1085438912 11:76538986-76539008 AAGTATTTAAATGGATTTAAGGG - Intronic
1086031719 11:82366868-82366890 AGGAAATTACATGGTGTTAACGG - Intergenic
1086042090 11:82491872-82491894 ATGTAATTATATGGTTTTAAGGG + Intergenic
1086082612 11:82920668-82920690 ATGTATTGGCATGGTTTTGAAGG + Intronic
1086264822 11:84985325-84985347 ATGTATTCGCATGGTTTTGAGGG - Intronic
1086297830 11:85390637-85390659 ATGTATTTGCATGATTTTGAGGG - Intronic
1086648436 11:89255105-89255127 ATGTATTTGCCTGGTTTTGAAGG + Intronic
1086825131 11:91487028-91487050 ATGTATTTGCAGGATTTTGAAGG + Intergenic
1086880486 11:92147703-92147725 ATTTATTTGCATCTTTTTAAAGG + Intergenic
1087387043 11:97484747-97484769 TTGTATTTCCATGGGTTCAATGG - Intergenic
1087395518 11:97591872-97591894 ATGTATTTGTATGGTTTTGAGGG - Intergenic
1087649006 11:100842667-100842689 ATTTATTTGCATGGTTTTGAAGG - Intronic
1087688710 11:101295113-101295135 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1087690290 11:101313339-101313361 ATGTATTTGCATGGTTTTGTGGG + Intergenic
1087731714 11:101785745-101785767 ATGTATTTGTATAGTTTTAAGGG + Intronic
1087766854 11:102164696-102164718 ATGTATCAACTTGGTTTTAGTGG + Intronic
1087804554 11:102541704-102541726 AGGTATTTGCATGGTTTTGAAGG - Intergenic
1087933886 11:104008611-104008633 AAGTCTTTACTTAGTTTTAAAGG - Intronic
1088179746 11:107095465-107095487 TTGTATTTGCATGGTTTTGAAGG - Intergenic
1088180757 11:107106819-107106841 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1088304051 11:108389549-108389571 AGGTATTTGCATTTTTTTAATGG + Intronic
1088387818 11:109279252-109279274 ATGTATTTGCGTGGTTTTGAAGG + Intergenic
1088413284 11:109560414-109560436 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088413565 11:109564647-109564669 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088417721 11:109607930-109607952 ATATATTAACAGGCTTTTAAAGG + Intergenic
1088525744 11:110752114-110752136 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088580824 11:111314376-111314398 ATGCATTTGCATGGTTTTGAAGG - Intergenic
1088951382 11:114574059-114574081 ATGTATTTGCATGGTTTTGAGGG - Intronic
1088982602 11:114876925-114876947 ATGTATGTAAGTGGTTTCAAGGG - Intergenic
1090559255 11:127912796-127912818 ATGCATTTGCATGGTTTTTAAGG + Intergenic
1090682910 11:129080450-129080472 ATGTATTTGCATAGTTTTGAGGG - Intronic
1090711037 11:129385563-129385585 ATTTATTTAAATGGTTGAAAAGG + Intronic
1090791871 11:130097150-130097172 TGTTATTTTCATGGTTTTAATGG + Intronic
1090857045 11:130619294-130619316 ATGTTTTTAGATTTTTTTAATGG - Intergenic
1091210231 11:133851742-133851764 GTGTATTTGCATGGTTCTGAGGG + Intergenic
1092303607 12:7277025-7277047 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1092316309 12:7418232-7418254 ATGTATTTGCATTGTTTTGAGGG - Intronic
1092516173 12:9216205-9216227 ATGTAATTGTATGGATTTAAGGG - Intergenic
1093010765 12:14104357-14104379 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1093105183 12:15077724-15077746 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1093228282 12:16512496-16512518 TTGTTTTTACATTGTTTTATTGG - Intronic
1093254217 12:16845578-16845600 TTATATTTACAAGGTTTAAATGG + Intergenic
1093277787 12:17151178-17151200 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1093389833 12:18604743-18604765 ATGTATTTGTGTGGTTTTGAAGG - Intronic
1093408977 12:18842532-18842554 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1093415921 12:18920616-18920638 ATCTATTTAAATGATTTTAAAGG - Intergenic
1093451308 12:19318318-19318340 ATATATTTATATGGCTATAAAGG + Intronic
1093488473 12:19678937-19678959 ATGTATTTGCATGGTTTTCAAGG + Intronic
1093720813 12:22439809-22439831 ATGTATTTGCGTGGTTTTGAAGG - Intergenic
1093948647 12:25138553-25138575 ATTTATTTGCATGGTTTTGAGGG - Intronic
1093963990 12:25305913-25305935 ACATATTTGCATGGTTTTGAGGG - Intergenic
1093991663 12:25595427-25595449 ATGTGTTTGCATGGTTTTGAAGG - Intronic
1094263210 12:28525392-28525414 ATGTATTTGCATGGTTTTGAAGG + Intronic
1094297424 12:28923560-28923582 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1094501555 12:31025735-31025757 ATGTATTTACGTGGTTTCAAAGG - Intergenic
1094534931 12:31312925-31312947 ATATTTTTACATGGCATTAAAGG + Intronic
1094721787 12:33072972-33072994 ATGTACTTGCATGGTTTTGAAGG + Intergenic
1094789508 12:33895208-33895230 AAGTATATGCATGGTTTTGAGGG - Intergenic
1094878456 12:34681241-34681263 GTGTATTTAGAGGGCTTTAAGGG + Intergenic
1095118003 12:38379420-38379442 ACGTATTTGCATGGTTTTGAAGG + Intergenic
1095121069 12:38419975-38419997 ATGTATTTATATGGTTTTGAGGG - Intergenic
1095176554 12:39098617-39098639 ATGTATTTGCATGGTTTCGAGGG - Intergenic
1095500808 12:42836722-42836744 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1095562248 12:43579577-43579599 ATGTATTAACTTTGTTCTAAAGG + Intergenic
1095687637 12:45053007-45053029 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1095732989 12:45525306-45525328 ATGTAGTTGCATGGTTTCAAAGG - Intergenic
1095784716 12:46097006-46097028 ATGTATTTGCATAGTTTTGAGGG - Intergenic
1095932299 12:47639509-47639531 ATGTATTTGCATGGTTTCAAGGG - Intergenic
1096012085 12:48227141-48227163 ATGTATTTGCATGATTTCAAAGG + Intergenic
1096032106 12:48428019-48428041 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1096437733 12:51609026-51609048 ATGTATTTGCATGGTTTTGAAGG + Intronic
1096740718 12:53692092-53692114 ATATACTTTCATGGTTGTAAAGG + Intergenic
1096888353 12:54741272-54741294 ATGTATTTGCATAGTTTCAAAGG + Intergenic
1096897356 12:54836874-54836896 ATGTATTTGTATAGTTTTGAGGG + Intronic
1097295744 12:57960612-57960634 ATGTATTTGCATGGTTTTGATGG - Intergenic
1097324752 12:58263661-58263683 ATGTTTTTACATAGTCTTCATGG - Intergenic
1097385719 12:58948034-58948056 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1097513747 12:60576710-60576732 ATATATGTACATGTTTTTAAAGG + Intergenic
1097537154 12:60886790-60886812 ATGTATTTGCATAGTTTAGAAGG + Intergenic
1097547482 12:61022958-61022980 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1097603797 12:61728007-61728029 ATGTATTTGCATACTTTTGAGGG + Intronic
1097607349 12:61771577-61771599 ATGTATTTGCATAATTTTGAGGG - Intronic
1097659991 12:62419366-62419388 ATGTACTTGCATGGTTCTGAAGG - Intergenic
1097773901 12:63623706-63623728 ATATATTTACATTTTTTTAGAGG + Intronic
1098499833 12:71178552-71178574 ATGTATTTGTATAGTTTTGAGGG - Intronic
1098506740 12:71261228-71261250 TTGTATTTCCATTGTTTTGATGG + Intronic
1098622818 12:72625228-72625250 ATGTATTTAAATACTGTTAAAGG + Intronic
1098786229 12:74759662-74759684 ATGTATTTGCATGGTTTTGATGG + Intergenic
1098786627 12:74766459-74766481 TTGTATTTTTATGGTTCTAAAGG - Intergenic
1098982445 12:76971851-76971873 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1099092026 12:78324152-78324174 AGGTATTTTCAAAGTTTTAATGG + Intergenic
1099382575 12:81973228-81973250 ATGTGTTTGTATGGTTTTGAAGG - Intergenic
1099476921 12:83119436-83119458 GTGTATTTGCATGGTTCTGAAGG + Intronic
1100203350 12:92323016-92323038 ACATATTTGCATGGTTTTGAAGG + Intergenic
1100250292 12:92814270-92814292 ATACATTTACATTGATTTAAAGG + Intronic
1100290752 12:93212536-93212558 GTGTATTTGCGTGGTTTTGAAGG + Intergenic
1100569497 12:95833963-95833985 ATATATTAACATGGTTTTTATGG - Intergenic
1100697008 12:97105596-97105618 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1100706534 12:97206201-97206223 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1100707652 12:97219283-97219305 ATGTTCTAACATGATTTTAAAGG - Intergenic
1100918771 12:99458124-99458146 ATGTATTTGCATGGTTTTCAGGG - Intronic
1100937196 12:99682454-99682476 ATGTATTTCCATGGTTTTGAAGG - Intronic
1100951546 12:99855760-99855782 ATGTATTTCCATGGTTTTGAGGG - Intronic
1100970730 12:100067037-100067059 AGGTATTTGCATGGTTTTGAAGG - Intronic
1101392608 12:104316054-104316076 AAGTATTTACATAGTTGTTATGG + Intronic
1101635028 12:106533069-106533091 ATGTATTTGCATGGTTTTGAAGG + Intronic
1101981235 12:109408763-109408785 ATGTATTTATTTAGTTTTAAAGG - Intronic
1102447669 12:113016147-113016169 TGGTAAGTACATGGTTTTAATGG - Intergenic
1102916483 12:116757615-116757637 ATGTGTTTGCATGGTTTTGAAGG + Intronic
1103760525 12:123246620-123246642 ATTTATTTGTATGGTTTTGAAGG + Intronic
1104668401 12:130663819-130663841 ATGTATTTGCATATCTTTAAAGG - Intronic
1104741686 12:131180588-131180610 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1105598638 13:21864760-21864782 ATATATTTGCATGGTTTTGAGGG + Intergenic
1105716927 13:23075870-23075892 ATGTATTGATATAATTTTAAAGG + Intergenic
1105908515 13:24837546-24837568 ATGTATTTGCATGGTTTTGAAGG - Intronic
1105930993 13:25051893-25051915 TTGTATTTGCATGGTTTTGAAGG - Intergenic
1106362343 13:29043226-29043248 ATGTATTTGCCTGCTTTTGAGGG + Intronic
1106392010 13:29343945-29343967 ATGTATTTGCATGCTTTTGAGGG + Intronic
1106424786 13:29616389-29616411 ACATATTTGCATGGTTTTAAGGG - Intergenic
1106749709 13:32749692-32749714 AACTAATTACATGGTATTAATGG + Intronic
1106947885 13:34848833-34848855 TTGTTTTTACATTGTTATAAAGG - Intergenic
1107226022 13:38048233-38048255 ATGTAATTTTATGGTTTTGAGGG - Intergenic
1107253081 13:38389646-38389668 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1107701801 13:43056032-43056054 ATGTATTTGCATGGTTTTGAGGG + Intronic
1107755746 13:43620538-43620560 ATGTATTTGCATGGTTTTGAAGG + Intronic
1108132121 13:47312921-47312943 ATATATTTGCTTGGTTTTGAGGG - Intergenic
1108189264 13:47920500-47920522 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1108469541 13:50753966-50753988 ATGTATTTGCATGGTTTTGAAGG + Intronic
1108817320 13:54307714-54307736 TTGTGTTTGCATGGTTTTGAAGG - Intergenic
1108825803 13:54410655-54410677 ATGTGTTTGCATGGTTTTGAAGG - Intergenic
1108831880 13:54489428-54489450 ATGTATTTTCATGGTTTGGAGGG - Intergenic
1108902299 13:55426656-55426678 ATGCAGTTGCATGGTTTTGAGGG - Intergenic
1108917000 13:55626759-55626781 ATGCATATCCAAGGTTTTAAAGG + Intergenic
1109001930 13:56815654-56815676 ATGTATTTGTATAGTTTTTAGGG - Intergenic
1109047670 13:57434782-57434804 ATGTATTTGCATGGTTTTGATGG + Intergenic
1109125370 13:58510963-58510985 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1109201118 13:59432474-59432496 ATGTATTTTCATGGTTTTGAGGG + Intergenic
1109213345 13:59560668-59560690 ATGTTTTTGCATTGTTTTGAGGG + Intergenic
1109406943 13:61913092-61913114 ATATATTTACATGGATTCTATGG + Intergenic
1109484814 13:63004710-63004732 ATGTATTTGTATGATTTTAAGGG - Intergenic
1109566575 13:64123938-64123960 ATATATTTACATGATTTAAGTGG - Intergenic
1109567337 13:64134358-64134380 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1109596863 13:64567819-64567841 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1109617990 13:64862263-64862285 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1109625229 13:64965326-64965348 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1109716013 13:66223331-66223353 ATCTATTTACATTTTTTTGAAGG + Intergenic
1109945577 13:69427136-69427158 ATGTATTTGGATGGTTTTGAGGG - Intergenic
1110091600 13:71455715-71455737 ATCTTTTTAGATGCTTTTAAGGG - Intronic
1110097147 13:71541703-71541725 ACATTTTTACATGGTGTTAAGGG + Intronic
1110182062 13:72628821-72628843 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1110247862 13:73347458-73347480 ATGTATTTAAGTGGTTAGAATGG - Intergenic
1110340698 13:74386538-74386560 ATGTATTTGCATGGTTTGGGAGG + Intergenic
1110365864 13:74685115-74685137 ATGTTTTTACATGGCTTGATGGG - Intergenic
1110375782 13:74792390-74792412 ATGTATTTTCATGGTTTTAGGGG + Intergenic
1110504944 13:76274529-76274551 AAGTATTTGCATAGTTTTGAGGG - Intergenic
1110627804 13:77670919-77670941 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1110790172 13:79579169-79579191 ATGTAGTTTTATGGTTTTGAGGG + Intergenic
1110843376 13:80167674-80167696 AAGTATATACATGTTATTAAAGG - Intergenic
1110917222 13:81036505-81036527 ATAATTTTACATGCTTTTAATGG - Intergenic
1110946135 13:81420707-81420729 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1111036613 13:82682585-82682607 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1111059551 13:82997760-82997782 ATGTATTTTGATGGTTTTATTGG - Intergenic
1111148708 13:84219260-84219282 ATGTATTCTCATTGTTTTGAGGG - Intergenic
1111266282 13:85819066-85819088 ATGTAATTATAAAGTTTTAATGG - Intergenic
1111748118 13:92295310-92295332 ATGTATTTGCATGGTTTTGAAGG + Intronic
1111751868 13:92343020-92343042 ATCTATTTAAATTATTTTAACGG - Intronic
1112035161 13:95490559-95490581 ATGTATTTGCATGGTTTTGAAGG + Intronic
1112087226 13:96044214-96044236 ATGTATTTGCATGGTTTTGAAGG - Intronic
1112250869 13:97778969-97778991 ATGTATCTGCATAGTTTTGAGGG + Intergenic
1112738367 13:102446200-102446222 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1113240530 13:108331681-108331703 ATTTATTTGCATGGTTTTGAAGG - Intergenic
1113534801 13:111057119-111057141 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1113845388 13:113386095-113386117 ATGTATTTGCATGGTGTTGAAGG + Intergenic
1114691940 14:24591572-24591594 ATGTATTTGCATGATTTTGAAGG + Intergenic
1114698431 14:24650059-24650081 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1114722848 14:24900754-24900776 ATTTATTTCCATGATTTTAATGG - Intronic
1114788989 14:25634721-25634743 TTCTATTTAAATGGTTTAAAAGG - Intergenic
1114902895 14:27087234-27087256 GTGTATTTACATACTTATAAAGG - Intergenic
1115122459 14:29953897-29953919 ACGTGCTTACATGGTTTTCAGGG - Intronic
1115151835 14:30294842-30294864 ATTTATTTACATATTTTTGATGG - Intergenic
1115299497 14:31868003-31868025 ATGTATTTGCATGTTTTTGAAGG - Intergenic
1115350400 14:32388643-32388665 ATGTATTTGCATGGTTTTGAAGG + Intronic
1115526947 14:34290699-34290721 ATGTATTTGCATGGTTTTGAAGG + Intronic
1115678136 14:35703979-35704001 TTGTATTTATATGCTGTTAAGGG - Intronic
1115680558 14:35733098-35733120 ATATATTTGCATGGTTTTGAAGG - Intronic
1115937887 14:38575486-38575508 ATGTATTTGCATGGCTTTGAGGG + Intergenic
1115997283 14:39207399-39207421 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1116048802 14:39778769-39778791 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1116064103 14:39960756-39960778 ACGTATTTGCATGGTTTTGAGGG - Intergenic
1116335740 14:43653982-43654004 ATGTATTTGCATGGTTTTGGAGG - Intergenic
1116386968 14:44343184-44343206 ATGAGTTTACATGTTATTAAGGG + Intergenic
1116732236 14:48638528-48638550 ATGTTTTTGCATGGTTTTGAAGG - Intergenic
1117113007 14:52478027-52478049 ATGTATTTGCATGGTTTTGAAGG - Intronic
1117182438 14:53205020-53205042 ATGTATTTGCATGGCTTTGAGGG - Intergenic
1117193207 14:53314010-53314032 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1117271593 14:54149416-54149438 ATGTAGTTGCATGGTTTTGAGGG - Intergenic
1117318587 14:54598653-54598675 CTGTATTTTTCTGGTTTTAAAGG + Intronic
1117509895 14:56440366-56440388 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1117768768 14:59110541-59110563 ATGTATTTGCATGGTTTTAGAGG - Intergenic
1117892546 14:60442029-60442051 ATGAGTTAACATGTTTTTAAAGG + Intronic
1117965015 14:61198158-61198180 ATGTATTTAAGTGTATTTAAGGG + Intronic
1118139917 14:63069604-63069626 ATGTATTTGCATAGCTTTGAGGG + Intronic
1118165854 14:63335261-63335283 ATGGATTTGCATGGTTTTGAAGG - Intergenic
1118421073 14:65604449-65604471 ATATATTTGCATGGTTTTAAAGG - Intronic
1118423888 14:65636637-65636659 ATGTGTTTGCATGGTTTTAAAGG + Intronic
1118581893 14:67308909-67308931 GTTTATTTACATGTTTTTTAGGG - Intronic
1118809742 14:69264387-69264409 ATGTAAATACATGGCTTTAAGGG + Intronic
1119009284 14:70967479-70967501 ATTTATTTATATGATTTTCATGG + Intronic
1119098711 14:71858800-71858822 ATGTATTTGCATGACTTTGAAGG - Intergenic
1119582442 14:75798756-75798778 ATGTACTTGCATGGTGTTGAGGG + Intronic
1119913064 14:78368803-78368825 ATGGATTTATGAGGTTTTAAGGG + Intronic
1120379258 14:83752926-83752948 ATGTATTTAAATAATTTCAAAGG - Intergenic
1120450701 14:84663521-84663543 ATGTATATGCATGGTTTTGAAGG + Intergenic
1120489833 14:85163361-85163383 ACGTATTTGCATGGTTTTGATGG - Intergenic
1120545524 14:85806934-85806956 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1120723573 14:87913890-87913912 ATGTAATTATATGGTTTTGAGGG + Intronic
1120736123 14:88055039-88055061 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1120785512 14:88531137-88531159 ATTTATTTATATAGTTTTGAGGG - Intronic
1121460106 14:94068710-94068732 ATGTATTTGCATGGTTTTGAAGG - Intronic
1121475800 14:94201117-94201139 ATGTATTTGCATGGTTTTGAGGG + Intronic
1121503238 14:94456311-94456333 ATGTATTTGCATGATTTTGAAGG + Intergenic
1121575671 14:94984032-94984054 ATGTATTTGCACGGTTTTGAGGG - Intergenic
1121848208 14:97194035-97194057 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1122205968 14:100148138-100148160 ATGTATTTACCTGGTTGTGCAGG - Intronic
1123104044 14:105829003-105829025 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1123431168 15:20217925-20217947 ATTTATTTTGCTGGTTTTAATGG + Intergenic
1124380964 15:29165020-29165042 ATGTATCAGCATGGTTTTGAAGG - Intronic
1124386708 15:29214737-29214759 ATGTATTTGCATGGTTTTGAAGG + Intronic
1124557372 15:30738826-30738848 ACGTATTTGCATGGTTTTGAAGG - Intronic
1124668094 15:31611002-31611024 ATGTGTTTGCATGGTTTTGAAGG - Intronic
1124673886 15:31666922-31666944 ATGTATTTGCATGGTTTTGAAGG + Intronic
1125178645 15:36856052-36856074 ACGTATGTACAAGGATTTAAAGG + Intergenic
1125269121 15:37918922-37918944 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1125273218 15:37963344-37963366 GTGTATTTGCATGGTTTTGAAGG + Intronic
1125423594 15:39528473-39528495 ATCTAGTTCCATGGTTCTAAAGG + Intergenic
1125649510 15:41303481-41303503 ATGTATTAACATGGCTGTTAAGG - Intergenic
1126064097 15:44811866-44811888 ATGTATTATCAGGGTTTTACAGG - Intergenic
1126190788 15:45876153-45876175 ATGTGTTTGCATGGTTTTGAGGG - Intergenic
1126209762 15:46087831-46087853 AGGCTTTTACATGATTTTAAAGG + Intergenic
1126244799 15:46491931-46491953 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1126460536 15:48910858-48910880 ATGTATTTGCAGGGTTTTGAAGG + Intronic
1126488365 15:49208445-49208467 ATGTATTTGCATGGTTTTGAAGG + Intronic
1126504320 15:49386350-49386372 ATGTATTTGTATAGTTTTGAGGG - Intronic
1126521280 15:49597320-49597342 AGGTATTTGCATGGTTTTAAGGG - Intronic
1126566157 15:50101940-50101962 ATTTATTTGCATGGTTTTAAGGG - Intronic
1126572963 15:50171404-50171426 ATGTATTTGCATGGTTTTGAAGG - Intronic
1126577775 15:50213658-50213680 CTGTATTTGCATGGTTTTGAAGG - Intronic
1126977519 15:54200520-54200542 ACGTATTTGCACGGTTTTGAGGG - Intronic
1127050382 15:55077021-55077043 ATGTATTTACATGGATTTGAAGG - Intergenic
1127573727 15:60269959-60269981 ATGAATTTTCATGGTTTTGAGGG + Intergenic
1127691619 15:61402745-61402767 ATTCATTGCCATGGTTTTAAAGG - Intergenic
1127694439 15:61431046-61431068 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1128238989 15:66087522-66087544 ATGTATTTACATGGTTTTGAAGG - Intronic
1128418683 15:67470728-67470750 ATATATTCACATGGTTCAAAAGG + Intronic
1128587420 15:68861761-68861783 ATGTGGTTACATGTTTTAAAGGG + Intronic
1128589486 15:68882280-68882302 ATGAATTGATAGGGTTTTAATGG - Intronic
1128820825 15:70651439-70651461 ATGAATAAAGATGGTTTTAAAGG + Intergenic
1129097351 15:73223085-73223107 ATGTATTTGCATGGCTTTGAAGG + Intronic
1129222287 15:74137996-74138018 TTGTGTTTACATTGTTTTTATGG - Intronic
1129570164 15:76673911-76673933 ATGGATTTAAATGTTTTTAATGG - Intronic
1129632137 15:77271964-77271986 ATATATTTGCATGGTTTTGAAGG - Intronic
1130405277 15:83594719-83594741 ATGTCTTTACATGGTTAGACTGG + Intronic
1130749532 15:86695887-86695909 ATGTATTTGCATGGTTATGAAGG + Intronic
1131029118 15:89171493-89171515 AAGCAGTTACATGGATTTAAAGG + Intronic
1132210047 15:100014653-100014675 ACGTATTTGCATGATTTTGAAGG + Intronic
1132254000 15:100358402-100358424 ATGTATTTGCCTGGTTTTGATGG - Intergenic
1132412665 15:101595843-101595865 ATGTATTTGCATGATTTTGAGGG + Intergenic
1135628715 16:24018750-24018772 AAGTGTTTACATGGTGTTATTGG + Intronic
1135901879 16:26467611-26467633 ACGTATTTGCATGGTTTTGAAGG - Intergenic
1135917643 16:26620316-26620338 ACATATTTGCATGGTTTTGAAGG + Intergenic
1136853478 16:33633323-33633345 ATTTATTTTGCTGGTTTTAATGG - Intergenic
1136932296 16:34430117-34430139 ATGTGTTTGCATGGTTTGGAAGG + Intergenic
1136972276 16:34981697-34981719 ATGTGTTTGCATGGTTTGGAAGG - Intergenic
1137004940 16:35267144-35267166 ATATATTTATATGGTTAGAAGGG - Intergenic
1137642151 16:50041747-50041769 TTGTTTTTAAATGGTTTTCAGGG - Intergenic
1138710504 16:58965478-58965500 ATGTATGTACAGGGTTCCAAAGG - Intergenic
1139024161 16:62793373-62793395 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1139024873 16:62804340-62804362 ATATATTTCTGTGGTTTTAATGG + Intergenic
1139028441 16:62848818-62848840 ATGTATTGACAGGGTTTGATAGG + Intergenic
1139987674 16:70913419-70913441 ATGTATTTGCATGGCTTTGAAGG + Intronic
1140064165 16:71595953-71595975 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1140527665 16:75637041-75637063 ATGTCTTTAACTGGTTTGAATGG - Intronic
1140531090 16:75666928-75666950 ATATATTTGCATGGTTTTGAAGG - Intronic
1140613694 16:76633800-76633822 ATGTAATTACATGTTTATATAGG + Intronic
1141206932 16:81939782-81939804 ATTTATTTACATGGTTGCTAAGG + Intronic
1203115072 16_KI270728v1_random:1481767-1481789 ATTTATTTTGCTGGTTTTAATGG - Intergenic
1142840919 17:2629386-2629408 ATGTATTTGCATGGTTTTGAAGG + Intronic
1142910555 17:3086798-3086820 ATGTATTTGGATGGTTTTGTGGG + Intergenic
1143721375 17:8812603-8812625 ATGTATTTAAATAGTTTTGAGGG - Intronic
1144139428 17:12334133-12334155 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1144278132 17:13696802-13696824 ATGTATTTACATGGTTTTGAAGG + Intergenic
1144407954 17:14971093-14971115 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
1144597991 17:16587719-16587741 TTGTGTTTACATTGTTTTTATGG - Intergenic
1145403133 17:22560979-22561001 GTCTATTTACATGCTTTTACAGG + Intergenic
1146583638 17:34062221-34062243 ATGTATTTGCATGGTTTTGAAGG - Intronic
1146751202 17:35382528-35382550 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1147462949 17:40586691-40586713 ATGTATTTGCATAGTTTTGAAGG + Intergenic
1148400350 17:47354170-47354192 CTGTATTTGCATAGTTTTGAGGG + Intronic
1148408006 17:47437053-47437075 TTGTATTTGCATGGTTTTGAAGG + Intronic
1149041414 17:52193858-52193880 TGCTATTTACATGGTATTAATGG + Intergenic
1149052534 17:52324286-52324308 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1149410665 17:56402989-56403011 ATGTATTTGCATGGTTTTGAAGG + Intronic
1149476694 17:56966990-56967012 TTGTATTTAAAAGGTCTTAATGG + Intergenic
1149971125 17:61219620-61219642 GTGTTTTAACAGGGTTTTAATGG + Intronic
1150512492 17:65771352-65771374 ATGTATGTACCTAATTTTAAGGG + Intronic
1150818524 17:68415313-68415335 ATGTATTTGCATGGTTCTGAAGG + Intronic
1150939712 17:69677943-69677965 AAACATTTACATGGTTTCAAAGG + Intergenic
1150945241 17:69738798-69738820 ATGTATTTGCAGGGTTTTGAAGG + Intergenic
1151048630 17:70950311-70950333 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1151079049 17:71307290-71307312 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1153065693 18:1042228-1042250 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1153069252 18:1086839-1086861 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1153071704 18:1113484-1113506 ATGTATTTGCATGGTTTTGGAGG + Intergenic
1153079672 18:1208021-1208043 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1153176084 18:2375053-2375075 ATGTCTTTGCATGGTTTTGAGGG + Intergenic
1153268954 18:3299758-3299780 ATGTATTTGTATAGTTTTGAAGG - Intergenic
1153400714 18:4681468-4681490 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1153443501 18:5147161-5147183 TTGTATTTTAATGGTTCTAATGG - Intronic
1153869715 18:9306523-9306545 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1154014245 18:10602565-10602587 ATGTGTATACTTTGTTTTAAAGG - Intergenic
1154090236 18:11351914-11351936 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1154473913 18:14733029-14733051 ATTTATTTAGATGGCTTTACAGG - Intronic
1155573597 18:27221459-27221481 ATATATTTGCATAGTTTTGAGGG + Intergenic
1155886986 18:31220150-31220172 ATGTATTCATATAGTTTTGAGGG - Intergenic
1155946903 18:31863455-31863477 ATATATTTTCATGCTCTTAATGG - Intronic
1156011078 18:32498663-32498685 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1156326903 18:36082305-36082327 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1157218830 18:45809569-45809591 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1157631421 18:49101137-49101159 ATCTATTTTAATAGTTTTAATGG - Intronic
1157681032 18:49607022-49607044 GTGTATTTACATGGGCTTATTGG - Intergenic
1157996284 18:52560226-52560248 ATTTATTTACATACTTTTAATGG - Intronic
1158002857 18:52639008-52639030 ATGTATATGCATGGTTTTGAAGG - Intronic
1158046284 18:53159192-53159214 ATGTTTTTACATGGATTTCCTGG + Intronic
1158307457 18:56122050-56122072 ATATATTTCCATGTTTTTACTGG + Intergenic
1158323235 18:56286574-56286596 ATGTAGTTACATTCTTTAAAGGG - Intergenic
1158756751 18:60334277-60334299 ATGTGTTTGCATGGTTTTGAAGG - Intergenic
1158918528 18:62163015-62163037 AGTTATTTACATGTTTCTAATGG - Intronic
1158972181 18:62678900-62678922 TTGTTTTTACATTTTTTTAAAGG + Intergenic
1159193244 18:65076521-65076543 ATGAATTTACAATATTTTAATGG + Intergenic
1159430653 18:68348612-68348634 TTGTATTTTCATGGTTTTGAAGG - Intergenic
1159612637 18:70543578-70543600 ACGTATTGTCATGGTTTTGAGGG + Intergenic
1160151800 18:76400949-76400971 TTGTGTTTACATCATTTTAATGG - Intronic
1160219567 18:76964353-76964375 ATGTATTTGCATGGTTTTGAAGG + Intronic
1160455977 18:79000807-79000829 ATGTATTTAAATAATTTTTAGGG - Intronic
1161760803 19:6170534-6170556 ATGTATTTGTGTGGTTTTGAGGG + Intronic
1162709864 19:12584792-12584814 CTGGATTTGCATGGTTCTAATGG - Intronic
1163383509 19:16984836-16984858 GTGTATGTACTTGGTTTTTAGGG - Intronic
1163855626 19:19699521-19699543 ATGTATTTGCATGGTTTTGATGG + Intergenic
1163871692 19:19826897-19826919 GTGTATTTGCATGGTTTTGATGG - Intergenic
1163886334 19:19968204-19968226 AAGTATTTGCATGGTTTTGATGG + Intergenic
1163888132 19:19987258-19987280 ATGTATTTGCATGGTTTTGATGG - Intergenic
1163897283 19:20070539-20070561 GTGTATTTGCATGGTTGTGAGGG - Intergenic
1163908005 19:20164286-20164308 ATGGATTTGCATGGTTTTGAGGG - Intergenic
1163968130 19:20767619-20767641 ATGTATTTGCATTGTTTTGATGG - Intronic
1164018147 19:21271118-21271140 ATGTATTTACATTGTTTTGAAGG + Intronic
1164026059 19:21354312-21354334 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1164053246 19:21600796-21600818 AAGAAGTTACATGATTTTAAAGG - Intergenic
1164125459 19:22311484-22311506 ATGTATTTGCATGGTTTTGAAGG + Intronic
1164132095 19:22372998-22373020 ATTTATCTATATTGTTTTAAAGG - Intergenic
1164287971 19:23839228-23839250 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1164661789 19:29979358-29979380 GTGTTTTTACATAATTTTAAAGG + Intronic
1165983210 19:39743901-39743923 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1166479427 19:43157247-43157269 ATGTGTTTGCATGGTTTTGAAGG + Intronic
1166604007 19:44124306-44124328 ATGTATTTGCATGGTTTTGAAGG + Intronic
1166899914 19:46052342-46052364 ATGTATTTGCATGGTTTTGAAGG - Intronic
1167607728 19:50490412-50490434 ATGTAGTTTGATGCTTTTAAGGG - Exonic
1168395841 19:56047519-56047541 ACGTGTTTGCATGGTTTTGAAGG + Intronic
924976599 2:181784-181806 ATGTTTTTGCCTGGGTTTAATGG + Intergenic
924992623 2:326318-326340 ATACATTTGCATGGTTTTGAGGG + Intergenic
925127224 2:1467479-1467501 ATGTATTTGCATGATTTTGAAGG + Intronic
925379301 2:3414138-3414160 ATAAATTTAAATGGTTTCAAAGG + Intronic
925600390 2:5602951-5602973 ATGAATTTACATGGTTATTGTGG - Intergenic
925652051 2:6101404-6101426 ATGTATTTGCATGGTTTTGAGGG + Intergenic
925666937 2:6267825-6267847 ATGTGTATACATGGTATTCATGG + Intergenic
925791417 2:7491599-7491621 ATGTATATACAGAGTTTTTATGG + Intergenic
925795470 2:7537276-7537298 ATGTGTTTGCATGGTTTTGAGGG + Intergenic
926866761 2:17368292-17368314 ATGTATTTGTATAGTTTTAAGGG + Intergenic
927024854 2:19056556-19056578 ATGTATGTGCATAGTTTTGAGGG + Intergenic
927036481 2:19182748-19182770 ATGTATTTTCATGGTTTTCAGGG + Intergenic
927363260 2:22262404-22262426 ATGTTTTGGCATGGTTTTGAAGG + Intergenic
927375135 2:22404590-22404612 ATGTTTTTATCTGGTTTTATTGG + Intergenic
927570721 2:24157117-24157139 ATGTATTTGCATGGTTTTGAGGG + Intronic
927722277 2:25391770-25391792 ATGTATTTGCATGGTTTTGAGGG - Intronic
928019574 2:27692290-27692312 ATGTATTTGTATAGTTTTGAAGG + Intronic
928356938 2:30624961-30624983 ATGTATTTGCATGGTTTTAAGGG - Intronic
928733945 2:34263848-34263870 ATGTATTTGCATGGTTTTGAAGG - Intergenic
928747707 2:34434564-34434586 ATGTATTTTGATGGTTTTGGTGG + Intergenic
928881103 2:36097538-36097560 ACATATTTACATTGTTTAAATGG + Intergenic
929010044 2:37432659-37432681 TTGTATTTGCATGGTTTTAAAGG + Intergenic
929037095 2:37704536-37704558 TTGCATTTGCATGGTTTTGAAGG + Intronic
929205868 2:39292089-39292111 ATGTAAATATATAGTTTTAAAGG - Intronic
929349146 2:40927360-40927382 ATGGAGTTACATAGTTTCAATGG + Intergenic
929722663 2:44386808-44386830 ATATATTTGCATGGTTTTGAAGG + Intronic
929806105 2:45146120-45146142 ATATATTTGCATGGTTTTGAAGG - Intergenic
930363098 2:50406781-50406803 ATTTATTTTAGTGGTTTTAAAGG - Intronic
930756485 2:54978868-54978890 ATGTATTTACCTTGTTTAAACGG - Intronic
931136212 2:59404501-59404523 CTGTATTTGCATGATTTTGAGGG - Intergenic
931524902 2:63142428-63142450 ATGTATTTGTATGGTTCTGAAGG + Intronic
931548112 2:63411231-63411253 ATGTATTTGCAAGGTTTTGAAGG - Intronic
931553918 2:63478527-63478549 ATGTATTTGCATGGTTTTGAGGG - Intronic
931834872 2:66088119-66088141 ATGTATTTGCATGGTTTTGAGGG - Intergenic
932100317 2:68893560-68893582 ATGTATTTGCATGGTTTTGAAGG + Intergenic
932384636 2:71320717-71320739 ATGCATTTGCATGATTTTGAAGG + Intronic
932432820 2:71685828-71685850 ATGTGTTTTCATGGTTTTTGGGG + Intronic
932879470 2:75487634-75487656 ATTTATTTATATGCTTTTCATGG - Intronic
932883883 2:75529596-75529618 ATATATTTGCATGGTTTTGAGGG - Intronic
932954405 2:76334959-76334981 ATGTATTTGCATGGTGTTGAAGG + Intergenic
933212620 2:79588154-79588176 ATGTGTTTACTGAGTTTTAAGGG + Intronic
933295517 2:80486414-80486436 ATGTGTTTCCATGGTTATTATGG - Intronic
933382154 2:81562041-81562063 ATGTATTTGCATGGTTTTGAGGG - Intergenic
933398152 2:81757668-81757690 ATGTATTTGCATGGTTTTAAAGG - Intergenic
933410965 2:81924511-81924533 ATGTATTTGCATGGTTTTGAGGG - Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
934111131 2:88744297-88744319 ATGTATTTGTATAGTTTTGAGGG + Intronic
934874285 2:97901094-97901116 ATGTATTTTCATATTTTTGAAGG - Intronic
935000876 2:99013687-99013709 ATGTATTTTTATAGTTTTGAGGG - Intronic
935007352 2:99092131-99092153 ATGTATTTGCATGGTTTTGAAGG - Intronic
935220285 2:101006085-101006107 ATGAATTTAAATGGCTTTATGGG - Intronic
935438891 2:103068624-103068646 ATGTATTTCCATTTTTATAAGGG + Intergenic
935610214 2:105015088-105015110 ATGTATTTGCATGGTTTTGAAGG + Intergenic
935954205 2:108359277-108359299 ATGTATTTGCTTGGTTTTGAAGG - Intergenic
936141117 2:109941588-109941610 ATGTATTTGTATAGTTTTAGGGG - Intergenic
936177805 2:110239533-110239555 ATGTATTTGTATAGTTTTAGGGG - Intergenic
936203576 2:110429898-110429920 ATGTATTTGTATAGTTTTAGGGG + Intronic
936701881 2:115020867-115020889 ATGTATTTGCATGATTCTGAGGG - Intronic
936776572 2:115981562-115981584 ATGTATTTGTATAGTTTTAGGGG + Intergenic
936852868 2:116922342-116922364 ATGATTTTTCATGGATTTAAGGG - Intergenic
936899079 2:117463740-117463762 GTGTATTTTTATGGTTTTGAGGG + Intergenic
936910916 2:117592629-117592651 ATGTATTTGCATGGTTTTGAAGG + Intergenic
937058108 2:118956841-118956863 ATGTATTTGCATGGCTTTGAAGG - Intronic
937173072 2:119896776-119896798 TTTTATTTACCTGGTTTTCAAGG + Intronic
937480545 2:122254005-122254027 ATGTATTTGCGTGGTTTTGAAGG - Intergenic
937561377 2:123228816-123228838 ATGTATGTACATGGTTTTGAAGG + Intergenic
937572898 2:123385694-123385716 ATGTATTTGCATGGTTTTAAAGG - Intergenic
937716101 2:125035103-125035125 ATGTATTTGTATAGTTTTGAGGG + Intergenic
937736042 2:125291187-125291209 ATGTATATGCATACTTTTAATGG + Intergenic
937767393 2:125677760-125677782 ATGTATTTGCATGGTTTTGAAGG + Intergenic
937781731 2:125846474-125846496 ATGTATTTGCATGATTGTGAAGG + Intergenic
937798692 2:126056256-126056278 ATGTATTTGCAGGTTTGTAAGGG + Intergenic
937813099 2:126220747-126220769 ATGTTTTTACATTTTTTAAATGG - Intergenic
937935925 2:127244663-127244685 GTGTATTTACATGTTAATAAAGG - Intergenic
937971829 2:127555689-127555711 ATGTATTTGCATGGTTTTGGAGG + Intronic
938173562 2:129104035-129104057 ATGTGTTTACATGATCTAAACGG + Intergenic
938509680 2:131927275-131927297 ATTTATTTGCATGGTTTTGAAGG - Intergenic
938598014 2:132809060-132809082 ACGTATTTGCATGGTTTTGAAGG + Intronic
938674775 2:133620969-133620991 ATGTATTCGCATGGTTTTGAGGG - Intergenic
938853776 2:135289219-135289241 ATGTATTTGCATGGTTTTGAGGG + Intronic
938859498 2:135352508-135352530 CTCTATTTACATGGTTAAAATGG - Intronic
938996651 2:136685950-136685972 ATGTATTTGCATGGTTTTGAGGG - Intergenic
939149738 2:138458939-138458961 ATTTATTTGCATGATTTTGAGGG - Intergenic
939245537 2:139618852-139618874 ATGTGTTTGCATTGTTTTGAGGG + Intergenic
939449436 2:142354283-142354305 ATGTAATTTCATGGTTTTGAGGG - Intergenic
939769800 2:146301246-146301268 ATATATTTGCATGGTTCTGAAGG - Intergenic
940034460 2:149299336-149299358 ATGTATTTGCATGATTCTGAAGG + Intergenic
940254360 2:151713459-151713481 AAGAATTTCCATGGTTTTAGAGG + Intronic
940423473 2:153505649-153505671 ATATATATGCATGGTTTTGAGGG + Intergenic
940544578 2:155067143-155067165 ATGTATTTGTATAGTTTTGAGGG + Intergenic
940618446 2:156081411-156081433 ATGTATTTCCATGGTTTTGAAGG + Intergenic
940709158 2:157141613-157141635 ATGTATTTGTGTGGTTTTGAAGG + Intergenic
940762636 2:157753957-157753979 ATCTATTTGCATGGTTTTGAAGG - Intronic
940784744 2:157969265-157969287 ATGTATTTGCATGGTTTTGAAGG + Intronic
940796583 2:158086783-158086805 AGGTATTTGCATGGTTTTGAAGG + Intronic
941102700 2:161313668-161313690 CTGTATTTTCTTGGTTTTGAAGG + Intronic
941230247 2:162903445-162903467 ATATATTTTCAAGGTATTAAGGG - Intergenic
941343524 2:164338173-164338195 ATTTATAAACATGGTTTCAATGG + Intergenic
941627678 2:167847435-167847457 ATGTATTTGCACAGTTTTGAAGG - Intergenic
941631375 2:167888745-167888767 ATGTATTTGCATGTTTTTAAAGG + Intergenic
941679863 2:168385936-168385958 ATGTATTTGTATGGTTTTGCAGG - Intergenic
941702346 2:168617080-168617102 ATGTATTTGCATGGTTTTGAAGG - Intronic
942154486 2:173113684-173113706 ATGTATTTGCATGGTTTTGAAGG + Intronic
942405557 2:175650405-175650427 ATGCATTTACATGGTTTTGAGGG - Intergenic
942726324 2:179011822-179011844 ATGTATTTTCATGGTTTTGAAGG - Intronic
943149702 2:184096713-184096735 ATGTAATTGCATCATTTTAAGGG + Intergenic
943167686 2:184351082-184351104 ATGTATTTGTATGGCTTTGAAGG - Intergenic
943265834 2:185730733-185730755 TTGTATTAACATAGTTTTACTGG + Intergenic
943447002 2:187998907-187998929 ATGTATTTGTATAGTTTTGATGG - Intergenic
943621134 2:190149613-190149635 ATATATTTGCATGGTTCTGAAGG + Intronic
943654523 2:190493720-190493742 ATTTATTTGCATGGTTTTGAAGG - Intronic
943891049 2:193287837-193287859 ATGCATTTCCATGGTTTTGAAGG + Intergenic
943909527 2:193545090-193545112 ATGTATTTGCATAGTTTTGAAGG - Intergenic
944420940 2:199529579-199529601 ATGTATTTTCATGGTTCTGAAGG - Intergenic
944431797 2:199641966-199641988 ATGTATTTGCATGGTTTTAGAGG + Intergenic
944528650 2:200646352-200646374 ATGTATTTGCATGGTTCTGAAGG + Intronic
945075387 2:206033435-206033457 ATGTATTTGGATGGTTTTGAAGG - Intronic
945131775 2:206581513-206581535 ACGTATTTGCATGGTTTTGAAGG + Intronic
945362619 2:208909706-208909728 ATGTATTTGCGTGGTTTTGAGGG - Intergenic
945377141 2:209092141-209092163 ACGTATTTGCATGGTTTTGAGGG + Intergenic
945387247 2:209217290-209217312 ATGTATTTGCATGGGTTCGAGGG - Intergenic
945480956 2:210345215-210345237 GTGTATTTGCATGGTTTTGAAGG + Intergenic
945620077 2:212125176-212125198 ATGTATTTACTTGCTTTATATGG - Intronic
945739038 2:213638536-213638558 ATGTATTTTCATGATTTTGAGGG + Intronic
945825990 2:214720457-214720479 ATGTATTTGCATGGTTTTAAAGG - Intergenic
945861428 2:215127085-215127107 ATGTGTTTGCATGGTTGTGAAGG + Intronic
945865028 2:215164525-215164547 ATGTATTTGCATGGTTTTAAAGG - Intergenic
945955621 2:216083272-216083294 TTGAATTTACTTTGTTTTAAAGG - Intronic
946036717 2:216748684-216748706 ATGTATTTGCATGGTTTTGAAGG - Intergenic
946525280 2:220512124-220512146 TTATATTTACATTGTGTTAAGGG + Intergenic
946824225 2:223660069-223660091 ATGTATTTGCATGGTTTTGAGGG - Intergenic
946828954 2:223707927-223707949 ATCTATTTCCATGCTTTAAATGG - Intergenic
947268846 2:228310475-228310497 TTGAATGTATATGGTTTTAAAGG - Intergenic
947456822 2:230262750-230262772 ATGTATTTGCATGGTTTTGGAGG + Intronic
948531431 2:238609105-238609127 ATGTATTTGCATGGTTTTGAAGG - Intergenic
948576959 2:238958996-238959018 ATGTATTTGCATGGTTTTGAGGG - Intergenic
948703600 2:239776177-239776199 TTATAGTTCCATGGTTTTAAGGG + Intronic
948746547 2:240099049-240099071 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1169335901 20:4756779-4756801 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1169401565 20:5285364-5285386 ATATATTCGCATGGTTTTGAAGG - Intergenic
1169507159 20:6223791-6223813 TTCTATTTCCATGGTTTTAGGGG + Intergenic
1169517205 20:6330646-6330668 ATGTATTTATGTGGTTTTGAAGG + Intergenic
1169528547 20:6457979-6458001 ACATATTTGCATGGTTTTGAGGG - Intergenic
1169840999 20:9937346-9937368 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1170124955 20:12952414-12952436 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1170133777 20:13051786-13051808 ATGTATTTGCATGGTTTTGAAGG - Intronic
1170375631 20:15697346-15697368 ATGTATTTGCATGGTTTTGAAGG + Intronic
1170489236 20:16855031-16855053 ATGTATTTGCATTGTTTTGAGGG + Intergenic
1170720785 20:18876882-18876904 ATGTATTTGCTTGGTTTTGAAGG + Intergenic
1170726686 20:18934754-18934776 ATATATTTGCATTGTTTTGAGGG + Intergenic
1170741279 20:19059279-19059301 ATGTATTTGCATTATTTTGAGGG - Intergenic
1170865607 20:20153070-20153092 ATGTATTTGTATAGTTTTGAGGG - Intronic
1170998309 20:21387671-21387693 CAGTATTTACATGCTCTTAATGG + Intronic
1171004381 20:21449910-21449932 ATTTATTTATGTGTTTTTAAAGG + Intergenic
1171066722 20:22024271-22024293 ATGTATTTGTATGGTTTTGAGGG + Intergenic
1171080336 20:22175681-22175703 AAGTATTTGCATGGTTTTAAGGG + Intergenic
1171081361 20:22188556-22188578 ATGTATTTCCATGGTTTTGAAGG + Intergenic
1171160243 20:22915843-22915865 ATGTATTTGCATGGTTTCAAAGG + Intergenic
1171165841 20:22969911-22969933 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1171232101 20:23495515-23495537 TTTTATTTACATTGTATTAAAGG + Intronic
1171369888 20:24655233-24655255 ATGTATTGAGAGGGTATTAATGG + Intronic
1171378424 20:24712467-24712489 ATGTATTTGGATGGTTTTGAAGG + Intergenic
1171515115 20:25724654-25724676 ATGTATTTATATAGTTTCCAAGG + Intergenic
1172851197 20:37966716-37966738 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1173127656 20:40354714-40354736 GTGTACTCACAAGGTTTTAAAGG - Intergenic
1173128900 20:40368089-40368111 ATGTCTTTAAAGGGCTTTAAAGG - Intergenic
1173568585 20:44060604-44060626 ATATATTTGCATTGTTTTGAGGG - Intronic
1174946012 20:54986145-54986167 ATGTAGTTGCATGGTTTGAGTGG - Intergenic
1174946751 20:54994566-54994588 ATTTATCTACATGTTTTAAAGGG - Intergenic
1175003313 20:55654094-55654116 ATGTAGTTACGCGGTTTTGAGGG - Intergenic
1175069366 20:56319226-56319248 ATGTATTTGCACGGTTCTGAAGG - Intergenic
1175075458 20:56368605-56368627 CTGTGTTTACATTGTTTTTATGG + Exonic
1175701626 20:61142328-61142350 TTCTATTAACATGGTGTTAATGG - Intergenic
1176658388 21:9610405-9610427 ATGTATTTGTATAGTTTTGATGG + Intergenic
1176694288 21:9956006-9956028 AGGTAATTATATAGTTTTAAGGG + Intergenic
1176700183 21:10038035-10038057 AAGCATTTTCATGGGTTTAAAGG + Intergenic
1176783795 21:13231291-13231313 ATTTATTTGCATGGTTTTGAAGG + Intergenic
1176906317 21:14505947-14505969 ATATATTTGCATGGTTTTGAAGG - Intronic
1177124511 21:17179678-17179700 TTGTATTTGCATGTTTTTGAGGG - Intergenic
1177127925 21:17218978-17219000 ATGTATTTGTATGGTTTTGAAGG - Intergenic
1177140812 21:17355977-17355999 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1177176704 21:17707445-17707467 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1177301480 21:19250896-19250918 ATGTATTTACATAGTTTCAAAGG - Intergenic
1177364316 21:20114695-20114717 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1177749895 21:25267913-25267935 ATATATTTGCATGGTTTCGAGGG - Intergenic
1177847564 21:26308403-26308425 ATGTATTTCCAGGGTTTTGAAGG - Intergenic
1177971764 21:27798859-27798881 ATTTATTTACATAATTTTATTGG + Intergenic
1177981847 21:27925130-27925152 ATTTATTTGCATGGTTTTGAAGG + Intergenic
1178064280 21:28886685-28886707 ATGTTTTTACATGGATTAGATGG - Intergenic
1178171432 21:30044768-30044790 ATGTATCTTCTTGGTTTTAGTGG - Intergenic
1178546102 21:33494130-33494152 ATGTATTTTTATAATTTTAATGG - Intergenic
1178733103 21:35123155-35123177 ATGTATTTGCATGGTTTTGAGGG - Intronic
1178959293 21:37049734-37049756 ATGTAGTTGCATGGTTTTGAAGG - Intergenic
1179083916 21:38200099-38200121 ATGTATTTGCATGGTTTTGAAGG + Intronic
1179268635 21:39829669-39829691 TTGTATTTGCATGGTTTTGCAGG + Intergenic
1179318081 21:40263408-40263430 ATGTATTTGTATAGTTTTGAGGG - Intronic
1179467533 21:41586720-41586742 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1180250986 21:46588154-46588176 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1180896611 22:19339151-19339173 ATGTATTTGTATAGTTTTGAGGG - Intronic
1181329909 22:22081939-22081961 TTGTATTTTTTTGGTTTTAAAGG + Intergenic
1181332588 22:22105298-22105320 ATGTATTTGTATAGTTTTAAGGG - Intergenic
1181426504 22:22846064-22846086 ATCTATCTACATGGTGTTTATGG + Intronic
1181454519 22:23049482-23049504 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1182682777 22:32095134-32095156 ATGTATTTGCATGGTTTTGAAGG + Intronic
1183048121 22:35238020-35238042 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1184529117 22:45043223-45043245 ATGTATCGATTTGGTTTTAATGG + Intergenic
949189861 3:1238789-1238811 ATGTATTTGCCTGGTTTTGAAGG - Intronic
949241279 3:1875327-1875349 ATGTATTGACATTTGTTTAATGG - Intergenic
949256828 3:2058281-2058303 GTGTATTTCCATGGTTTTTTTGG - Intergenic
949378221 3:3413746-3413768 ATGTATTTGCATGATTTTGAGGG - Intergenic
949380780 3:3443403-3443425 ATGTATTTAAATTCTTTTTATGG - Intergenic
949727438 3:7065878-7065900 ATGTATTTACATGATTATGAAGG - Intronic
949799393 3:7886746-7886768 ATGTATTTGCCTGGTTTTGAGGG - Intergenic
950588122 3:13911542-13911564 ATGTATTTGTATAGTTTTGAGGG - Intergenic
950592158 3:13945452-13945474 ATATATTTGCATGGTTTTGAAGG + Intronic
950594014 3:13962871-13962893 ATGTATTTGTATAGTTTTGAGGG + Intronic
950598990 3:14014733-14014755 ATGTATTTGTATGGTTTTGAAGG + Intronic
951153503 3:19321473-19321495 ATGTATTTGCATGGTTTTGAGGG + Intronic
951198399 3:19850225-19850247 ATGTATTTTCCTGATTTTGAGGG - Intergenic
951227671 3:20140200-20140222 ATGAATTTACTTGCTTTTCAGGG + Exonic
951260433 3:20501526-20501548 ATGTATTTATATAGTTTTCAGGG + Intergenic
951268234 3:20595209-20595231 ATGTATTTGCATGGTTTTGAGGG + Intergenic
951268629 3:20599275-20599297 ATGTAATTGTATGGTTTTGAGGG + Intergenic
951294722 3:20920014-20920036 ATGTTTTTGCATGATTTTGAGGG - Intergenic
951302463 3:21015188-21015210 ACATATTTGCATGGTTTTGAGGG + Intergenic
951572244 3:24076707-24076729 ATGTAGTTGCATAGTTTTGAAGG + Intergenic
951622499 3:24619619-24619641 ATGTATTTATATATCTTTAAAGG + Intergenic
951690787 3:25394190-25394212 ATGTATTTGCATGGTTTTGAGGG + Intronic
951750049 3:26025095-26025117 ATGTATTTGCATGGTTTTGAGGG + Intergenic
951761283 3:26149630-26149652 ATGTATTTGCATGGTTTTGAAGG - Intergenic
951764006 3:26176761-26176783 GTGTATTTGTATGGTTTTAAAGG + Intergenic
951817569 3:26771599-26771621 ATTTATTTTCATGCTTTTTATGG - Intergenic
951852191 3:27153654-27153676 ATGTATTTGCATGGTTTTGAAGG - Intronic
951967392 3:28401771-28401793 ATGTATTTGCATAATTTTGAAGG - Intronic
952523335 3:34184364-34184386 ATGTATTAACAGGGTTTTACAGG + Intergenic
952689617 3:36189748-36189770 ATGTATTTACATGGTTTGGAAGG + Intergenic
952714687 3:36468139-36468161 CTGTATTTGCATGGTTTCAAGGG + Intronic
952732719 3:36655821-36655843 ATGTATTGGCATAGTTTTGAGGG - Intergenic
952984615 3:38767531-38767553 ATGTATTTGTATAGTTTTGAGGG + Intronic
952993942 3:38858870-38858892 ATGTATTTGTATAGTTTTGAAGG - Intronic
953185518 3:40634180-40634202 ATGTATTTGCATGGTTTTCAGGG - Intergenic
953195543 3:40729329-40729351 ATGTATTTGCATGGTTTTGATGG + Intergenic
953195942 3:40733185-40733207 ATGTATTTGTATAGTTTTGAGGG + Intergenic
953276930 3:41510680-41510702 ATGTATTTGCATGGTTTTGAGGG - Intronic
953495379 3:43381916-43381938 ATGTATTTGCAGGGTTTCAAGGG - Intronic
953504410 3:43470164-43470186 ATGTCTTTTCATGGTTTGATAGG - Intronic
953639380 3:44691805-44691827 ATGTCTTTGCATGGTTTTGTGGG - Intergenic
954479918 3:50789268-50789290 ATGTATTTTCATGGTTTTGAGGG + Intronic
955175399 3:56608898-56608920 ATGTATTTGTGTGGTTTTGAAGG + Intronic
955859862 3:63317025-63317047 ATGTATTTTCATGGTTCTGAAGG + Intronic
956244364 3:67165124-67165146 ATGTATTTGTATAGTTTTGAAGG + Intergenic
956377153 3:68626320-68626342 ATGTATTTGCATGGTTTTGAGGG + Intergenic
956387207 3:68732712-68732734 TTGTATTAAAGTGGTTTTAAAGG - Exonic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956887078 3:73570891-73570913 ATGTATTTATAGGATGTTAAGGG - Intronic
956950503 3:74276487-74276509 ATGTATTTGCATGGTTTTAAAGG - Intronic
956995426 3:74821924-74821946 ATGTATTTGCATGGTTCTTAAGG + Intergenic
957016099 3:75066774-75066796 ATGTATTTGCATACTTTTGAAGG + Intergenic
957130644 3:76219192-76219214 ATGGTTTTACATGGTTTTTAAGG - Intronic
957395359 3:79629349-79629371 ATGTATTTGTATAGTTTTGAGGG - Intronic
957433162 3:80140007-80140029 ATGTATTTGCATGGTTTTGAGGG - Intergenic
957721359 3:84004344-84004366 AAGTATTTGCATGGTTTCGAGGG + Intergenic
957772361 3:84710724-84710746 ATGTATTTGAATGGTTTTGAAGG + Intergenic
958014055 3:87917061-87917083 ATGTATTTGCATGGTTTTGGAGG - Intergenic
958064316 3:88523611-88523633 ATGTATTTGCACGGTTACAAAGG + Intergenic
958066423 3:88549571-88549593 ATGTATTTGCATGGTTTTGAGGG + Intergenic
958070344 3:88602654-88602676 ATGTATTTGGATGGTTTTTAGGG - Intergenic
958088070 3:88838505-88838527 ATGTATTTGCATGGTTTTGAAGG + Intergenic
958444655 3:94200540-94200562 ATGTATTTGCATGGTTTTGGGGG + Intergenic
958480559 3:94641005-94641027 ATGTATTTGCATGGTTTTGAAGG + Intergenic
958605829 3:96357015-96357037 ATGTAAATGCATGGTTTTGAGGG - Intergenic
958646904 3:96886016-96886038 GTGTATTTGCATGTTTTTGATGG + Intronic
958742641 3:98093692-98093714 ATGTAGTTATGTGGTTTTGAGGG + Intergenic
958770905 3:98424404-98424426 ATGCATTTGCCTGGTTTTGAAGG - Intergenic
958775397 3:98477007-98477029 ATGTACTTGCATGGTTTTAAGGG + Intergenic
958818731 3:98948447-98948469 ATGTATTTGCATGGTTTTGAGGG + Intergenic
958969688 3:100598280-100598302 ATGTATTTGCATGGTTTTGAAGG + Intergenic
958971210 3:100611962-100611984 TTGTTTTTACATTTTTTTAAGGG + Intronic
959039764 3:101407635-101407657 ATGTGTTTGCATGGTTTTGAAGG - Intronic
959125681 3:102287967-102287989 ATTTATTTGCATGGTTTTAAGGG + Intronic
959192677 3:103135143-103135165 ATGTATTCACATGGTATAATAGG - Intergenic
959280147 3:104327072-104327094 ATGTATTTGCATGATTTTGAAGG - Intergenic
959325476 3:104931395-104931417 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959362064 3:105405752-105405774 ATGTATTTGCATGGCTTTGAGGG - Intronic
959424052 3:106164101-106164123 ATGTATTTACATGTTTTTCAGGG - Intergenic
959436411 3:106320036-106320058 ATGTTTTTGCATGCTTTTGAAGG - Intergenic
959475061 3:106800770-106800792 ATTTATTTATATCATTTTAATGG - Intergenic
959666251 3:108925415-108925437 ATGTATTTGCATGGTTTTGAGGG + Intronic
959715500 3:109428761-109428783 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959722066 3:109503137-109503159 ATGTATTTGCATTGTTTTAAAGG + Intergenic
959756737 3:109908575-109908597 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959875379 3:111376045-111376067 ATGTATTTGCATGGTTTTGAAGG - Intronic
959899300 3:111641846-111641868 GTGTATTTGCGTGGTTTTGAAGG - Intronic
959998313 3:112702576-112702598 ATGTATTTGCATAGTTTTGAAGG - Intergenic
960015453 3:112882840-112882862 ATGTAATTGTATGGTTTTGAAGG + Intergenic
960152840 3:114268407-114268429 ATGTATTTGCATGGTCTTGAGGG + Intergenic
960175985 3:114518208-114518230 ATGTGTGTACATGGTTGAAAGGG - Intronic
960296267 3:115948478-115948500 ATATATTTCTATGGTTTTGAGGG - Intronic
960315022 3:116165942-116165964 ATGTTTTTAGATGGTAATAAGGG - Intronic
960468428 3:118028343-118028365 ATGTATTTGTATAGTTTTGAGGG + Intergenic
960512615 3:118569285-118569307 ATGTATTTGCATGGTTTTGAAGG + Intergenic
960778465 3:121289757-121289779 ATGTATTTGCATAGTTTTGAGGG - Intronic
961414003 3:126744244-126744266 ATTTATTCACATGGTTTTTGGGG + Intronic
961967629 3:130922749-130922771 ATGTATTTATGTAGTTTTGAGGG + Intronic
962013150 3:131413213-131413235 ATGTATTTGCATGGTTTTGAGGG - Intergenic
962054260 3:131852144-131852166 ATGTACTTACAGAGTATTAAGGG + Intronic
962147200 3:132852843-132852865 ATGTATTTGCATGGTTTTGAGGG + Intergenic
962192118 3:133321877-133321899 ATGTATTTCTATAGTTTTGAGGG - Intronic
962401614 3:135064996-135065018 ATGTATTTGCATGGTTTTGAGGG + Intronic
962503133 3:136016110-136016132 ATGTATTTGCATGGTTTTGAGGG + Intronic
962504708 3:136034515-136034537 ATGTATTTGCATGGTTTTGAGGG + Intronic
962673450 3:137733392-137733414 ATGTATTTGCATGTTTTTGATGG + Intergenic
962709653 3:138075503-138075525 ATGTATTTGCATGGTTTTGAGGG - Intronic
962764873 3:138552523-138552545 ATGTATTTGCATGGCTTTGAAGG - Intronic
962861946 3:139412013-139412035 ATGTATTTGTATAGTTTTGAGGG + Intergenic
962931204 3:140038366-140038388 ATGTCTTTTCATACTTTTAATGG + Intronic
962983787 3:140515660-140515682 ATGTATTAGAATGGTTTTGAGGG + Intronic
962999622 3:140666562-140666584 ATGTATTTGCATGGTTTTGAAGG - Intergenic
963050861 3:141142334-141142356 ATGTATTTGTATAGTTTTGATGG + Intronic
963177367 3:142314225-142314247 ATGTATTTACATATTTTAACTGG + Intronic
963213450 3:142719579-142719601 ATGTATTTGCATAGTTTTGAAGG - Intergenic
963522296 3:146370595-146370617 ATGTATTTGCAGGGTTTTGAGGG + Intergenic
963664424 3:148164813-148164835 ATTTATTAATATGATTTTAAAGG + Intergenic
964017716 3:151967493-151967515 ATGTATTTGCACGGTTTTGAGGG - Intergenic
964075887 3:152691137-152691159 ATGTATTTGCATGGTTTTAAGGG - Intergenic
964160882 3:153643472-153643494 ATATATTTGCATGGTTTTGAAGG - Intergenic
964299622 3:155273809-155273831 ATGTATTTGCATGGTTTTGAGGG - Intergenic
964309530 3:155377694-155377716 ATGAGTTTATATTGTTTTAATGG - Intronic
964393593 3:156222778-156222800 ATATATTTGCATGGTTTTGAAGG - Intronic
964565113 3:158041485-158041507 ATGTATTTGTATAGTTTTGAGGG - Intergenic
964579725 3:158219443-158219465 ATGTAATTACATGGATTTTTAGG - Intronic
964865822 3:161259515-161259537 ATGTATTTACAAAGAATTAATGG - Intergenic
964867710 3:161279452-161279474 ATATATTTGCATGGTTTTGCAGG - Intergenic
964916100 3:161844022-161844044 ATGTATTTGCATGGTTTTGAAGG + Intergenic
965026938 3:163314304-163314326 ATCTATTTGCATGGTTTTCAAGG - Intergenic
965060836 3:163783853-163783875 AAGTATTTACATGATTTTGAGGG + Intergenic
965101768 3:164308111-164308133 AAGTATTTGCATGGTTTTGAGGG - Intergenic
965154260 3:165026669-165026691 ATGTATTTGCATGGTTTTGAAGG - Intronic
965216632 3:165872472-165872494 ATGTATTTTCATGGTTTTGAGGG + Intergenic
965291214 3:166883908-166883930 ATGTATTTATATAGTTTTAGGGG - Intergenic
965345391 3:167542485-167542507 ATGTATTTGTATAGTTTTGAGGG - Intronic
965479474 3:169199836-169199858 GTATATTTACATGTTTTCAAAGG + Intronic
965745658 3:171922632-171922654 ATGTATTTGTATTGTTTTGAAGG - Intronic
965874146 3:173297058-173297080 ATGTATTTACATGGTTTTGAAGG + Intergenic
965973871 3:174596721-174596743 ATTTCTTTTCATGGTTTTGATGG + Intronic
966352860 3:179049515-179049537 ATGTATTCGCATGGTTTTGAGGG - Intronic
966592015 3:181694831-181694853 AGGAATTTAAATGGATTTAAAGG + Intergenic
966604346 3:181807533-181807555 ATTCATGTACATGTTTTTAATGG + Intergenic
967209323 3:187152985-187153007 ATGTATTTGCATGTTTTTGAAGG - Intronic
967236341 3:187387507-187387529 ATGTATTTGTATAGTTTTGAGGG - Intergenic
967466933 3:189817916-189817938 AAGTATTTACATTTTTTAAATGG - Intronic
967488896 3:190065997-190066019 ATGTATTTGCATGGTTTTGAAGG + Intronic
967651634 3:191993020-191993042 ATGTATTTGGATGGTTTTGAAGG - Intergenic
967958462 3:194898495-194898517 ATGTATTTGTATAGTTTTGAGGG + Intergenic
968125407 3:196155694-196155716 ATGTATTTGCGTGGTTTTGAAGG + Intergenic
968696269 4:2030281-2030303 ATGTAGTGGCATGGTTTTGAGGG + Intronic
968720870 4:2203197-2203219 ATGTATTTGTATGGTTTTGAAGG - Intronic
969165423 4:5305997-5306019 ATGTATTTGCGTTGTTTTGAGGG + Intronic
969710087 4:8837819-8837841 ATCAATTTTCCTGGTTTTAAAGG - Intergenic
970217230 4:13772498-13772520 ATGTATTTGCATGGCTTCGAAGG + Intergenic
970346493 4:15157952-15157974 ATGTATTTGCATGGTTTTCAAGG + Intergenic
970549065 4:17161213-17161235 ATGTATTTGCATGGTTTTGAAGG + Intergenic
970699291 4:18715654-18715676 AAGTATCTAGATGGGTTTAATGG + Intergenic
971061975 4:22981986-22982008 ATGTATTTGTATAGTTTTAAGGG - Intergenic
971182876 4:24347057-24347079 ATGTATTTGCATGGTTTTGAAGG + Intergenic
971472039 4:27037574-27037596 ATATATTTGCATGGTTTTGAGGG + Intergenic
971554741 4:27999733-27999755 ATGTATTTGCATGGTTTTCAGGG + Intergenic
971720703 4:30242089-30242111 ATGCATTTATATAGTTTTGAAGG + Intergenic
971900823 4:32656089-32656111 ATGTATTTGCATGATTTTGAAGG + Intergenic
971921651 4:32948069-32948091 ATGCATTTGCATGGTTTTGAAGG + Intergenic
971938308 4:33182490-33182512 ATGTATTTGCATGGTTTTGAGGG + Intergenic
972049045 4:34704993-34705015 ATGTATTTGCATGGTTCTGAAGG - Intergenic
972065407 4:34936818-34936840 GTTTATTTACAAGTTTTTAAAGG - Intergenic
972184068 4:36506813-36506835 ATGTATTTTCAGGAATTTAAGGG - Intergenic
972188832 4:36566218-36566240 ATGTATTTGCATGGTTTTGAAGG + Intergenic
972827019 4:42770460-42770482 ATGTATTTGCATGGTTTTGAGGG - Intergenic
972899575 4:43666810-43666832 ATTTACTTGCATGGTTTTGAGGG + Intergenic
973068923 4:45833273-45833295 TTGTATTTGCATGCTTTTGAAGG + Intergenic
973091585 4:46144074-46144096 ATGTATTTATATAGTTTTGAGGG + Intergenic
973179345 4:47249301-47249323 ATGTATTTGCATGGTTTTGAAGG + Intronic
973342779 4:49023328-49023350 ATATATTTGCATGGTTTTGAAGG + Intronic
973675813 4:53261514-53261536 ATGTACTTGCATGGTTTTGAGGG + Intronic
973787298 4:54344304-54344326 ATGTATTTGGATGGTTTTGAAGG - Intergenic
973920373 4:55678289-55678311 ATGTGTTTGCATGGTTTTCAGGG - Intergenic
974256538 4:59462912-59462934 ATTTATTTACATGAATTCAATGG - Intergenic
974324417 4:60395268-60395290 ATGTTATTAAATTGTTTTAAGGG + Intergenic
974327703 4:60436353-60436375 ATGTATTTGCATGGTTTTGAAGG + Intergenic
974457943 4:62152333-62152355 ATGTGTTTGCATGGTTTTGAAGG - Intergenic
974801592 4:66825720-66825742 ATGTATTTTCATGGTTTTGTAGG + Intergenic
974857611 4:67479420-67479442 ATCTATTTGCTTGGTTTTGAGGG - Intronic
974963150 4:68728994-68729016 ATGTATTTATATAGCTTTGAGGG + Intergenic
975027559 4:69570222-69570244 ATGTGTTTACATATTTTTAATGG + Intergenic
975204307 4:71626718-71626740 ATGAATTTGCACGGTTTTGAGGG - Intergenic
975243572 4:72092129-72092151 ATGTATTTGCGTGGTTTTGTGGG + Intronic
975517535 4:75263023-75263045 ATGTATTTGCATGGTTTTGAAGG - Intergenic
975623466 4:76317856-76317878 ATGTATTTATATAGTTTTGAGGG - Intronic
975943045 4:79670804-79670826 ATATATTTGCATGGTTTTGAGGG - Intergenic
975948250 4:79735562-79735584 ATGTATTTACATGAATCTCATGG - Intergenic
976096232 4:81511104-81511126 ATGACTGTACATGTTTTTAAGGG - Intronic
976157259 4:82159860-82159882 ATGTATTTGCATGTTCTTGAAGG - Intergenic
976452440 4:85206164-85206186 ATGTATTTGCATGGTTTTGAAGG + Intergenic
976499643 4:85772713-85772735 TTGTATTTGCATGGTTTCTATGG - Intronic
976556437 4:86456005-86456027 ATGTATTTGCCTGGTTTTGAAGG - Intronic
976562554 4:86518907-86518929 ATGTATTTGTATAGTTTTGAGGG + Intronic
976686090 4:87817022-87817044 ATGTATTTGCATGGTTTTGAAGG + Intergenic
976791480 4:88883360-88883382 ATGTATTTGCATGGTTTTGAAGG - Intronic
976869793 4:89777306-89777328 ATGTATTTGTATAGTTTTGAGGG - Intronic
977019703 4:91744177-91744199 ATGTATTTGCATGGTTCTGAAGG + Intergenic
977294404 4:95194664-95194686 GTCTAATTACATGGTTTTGAAGG - Intronic
977489459 4:97693863-97693885 ATGTATTTGCATGGTTTTGAGGG - Intronic
977513680 4:97994259-97994281 ATGTATTTGCATGGTTTTGAGGG + Intronic
977549555 4:98426073-98426095 ATGTATTTGCATGGCTTTGAAGG - Intronic
977552247 4:98454401-98454423 ATGTATTTGCATGGCTTTGAGGG + Intergenic
977635752 4:99296163-99296185 ATGTATTTGCGTGGTTTTGAGGG - Intergenic
977828963 4:101567334-101567356 ATGTATTTGCATGGTTTTGAGGG - Intronic
977975854 4:103266113-103266135 AGGTATTTGCATGGTTTTGAGGG + Intergenic
978043967 4:104103861-104103883 ATGTATTTATATAGTTTTGGGGG - Intergenic
978087668 4:104673909-104673931 ATGTATTTGCATAGTTTTGTGGG + Intergenic
978158275 4:105514550-105514572 ATGTCTTTGCATGGTTTTGAGGG + Intergenic
978201771 4:106030675-106030697 ATGTATTTGCATGGTTTTAAGGG + Intergenic
978316709 4:107445935-107445957 ATGTATTTGCATGGTTTTGAAGG + Intergenic
978570780 4:110134647-110134669 ATGTGTTTACAGTGTTTAAAAGG + Intronic
978726439 4:111975227-111975249 ATGTATTTCCATGGCTTTGAAGG + Intergenic
978762064 4:112363908-112363930 ATGTATTTGCATGGTCTTGATGG - Intronic
978917319 4:114143331-114143353 TTGTATTTGCATGGCTTTCAGGG + Intergenic
978999198 4:115197027-115197049 ATGTATTGGCCTGGTTTTGAAGG + Intergenic
979159788 4:117445608-117445630 ATGTATTTGCATGGTCTCGAGGG + Intergenic
979160925 4:117460010-117460032 ATATATATATATGGTTTAAATGG - Intergenic
979202054 4:117990357-117990379 ATGTATTTGCATGGTTTTGAGGG - Intergenic
979295126 4:119023285-119023307 AAGTATTTAAATGGTCTTACAGG + Intronic
979355898 4:119705370-119705392 ATGTATTTGCATGGGTTTGAAGG - Intergenic
979381855 4:120015983-120016005 ATGTATTTGCATGGTTCTGAAGG + Intergenic
979434972 4:120677162-120677184 ATGTATTTGCATAGTTTTGAAGG - Intergenic
979498208 4:121408957-121408979 ATGTATTGGCATGGATTTGAAGG + Intergenic
979538803 4:121856020-121856042 ATGTATTTAAAATGTATTAAAGG - Intronic
979638653 4:122986066-122986088 ATGTATTTGCATGGTTCTGAAGG + Intronic
979705171 4:123712224-123712246 ATGTGTTTGCATGGTTTTGAAGG - Intergenic
979790524 4:124775215-124775237 ATGTATTTGTATAGTTTTTAAGG + Intergenic
979984702 4:127299250-127299272 ATGTATTTACATGGTTTTGAGGG - Intergenic
979995652 4:127427671-127427693 ATGTATTTGCGTGGTTTTGAAGG - Intergenic
980033641 4:127858997-127859019 ATGTATTTGAATGGTTTTGCGGG - Intergenic
980086971 4:128401413-128401435 ATGTATTTGCATGGTTTTGAAGG + Intergenic
980152973 4:129071069-129071091 ATGTATTTGCATGGTTTTGAAGG + Intronic
980190652 4:129520241-129520263 ATTTATATGCATGGTTTTATTGG + Intergenic
980195010 4:129577556-129577578 ATGTATTTGCATGGTTTTGAAGG + Intergenic
980238084 4:130134383-130134405 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
980263302 4:130482027-130482049 ATCTATTTGCATGGTTTTGAAGG - Intergenic
980271186 4:130585876-130585898 ATGTCTTTAAATGATGTTAAAGG - Intergenic
980366908 4:131816227-131816249 AGGTAATTATATAGTTTTAAGGG + Intergenic
980372591 4:131896790-131896812 AAGCATTTTCATGGGTTTAAAGG + Intergenic
980523842 4:133963688-133963710 ATGTATTTTCATGGTTTTGCAGG - Intergenic
980770603 4:137367584-137367606 ATTGAGTCACATGGTTTTAATGG - Intergenic
981346926 4:143686674-143686696 ATGTATTTGCATGGTTTTGAAGG - Intronic
981760558 4:148190325-148190347 ATGTATTTGTATGGTTTTGAAGG + Intronic
981795660 4:148592322-148592344 ATGTATTTGCATGATTTTGAGGG + Intergenic
982050154 4:151492683-151492705 ATGTATTTGTATAGTGTTAAGGG - Intronic
982119371 4:152126631-152126653 ATGTATTTGCATGGCTTTGAAGG + Intergenic
982127211 4:152194525-152194547 ACTTATTTGCATGATTTTAAAGG - Intergenic
982189521 4:152840041-152840063 ATGTATTTGCATGGTATCAAAGG + Intronic
982218529 4:153104713-153104735 AAGTATTTGCATGGTTTTGAGGG + Intergenic
982451296 4:155555145-155555167 ATGTATTTTCATGGTTTTGAGGG - Intergenic
982487116 4:155979193-155979215 ATATATTTGCATGTTTTTGAAGG + Intergenic
982614282 4:157621385-157621407 TTTTATTTACATAATTTTAATGG + Intergenic
982630873 4:157827427-157827449 ATGTATTTGCATGGTATTGAAGG - Intergenic
982809102 4:159804174-159804196 ATGTAATTTCATGTTTTTAATGG + Intergenic
982829985 4:160047013-160047035 ATGTATTTGCATGGTTTTGAAGG - Intergenic
982975788 4:162058120-162058142 ATACATGTACATGGTTATAAGGG + Intronic
982992028 4:162288556-162288578 ATATATTTGCATGATTTTGAGGG - Intergenic
983036084 4:162867501-162867523 ACATATTTGCATGGTTTTGAGGG - Intergenic
983040965 4:162925607-162925629 ATGTTTTTACATTGTTTTTATGG + Intergenic
983175465 4:164583258-164583280 ATGTATTTGTATGGTTTTGAAGG + Intergenic
983310092 4:166048365-166048387 ATTTATTTCCATAGTTTTCAAGG - Intronic
983544635 4:168950384-168950406 ATGTATTTGCATGGTTTTGTAGG + Intronic
983569523 4:169189925-169189947 ATGTATTTGCATGGTTTTGAAGG - Intronic
983749667 4:171250634-171250656 ATGTATTTGCATAGTTTTGAGGG + Intergenic
983894324 4:173065741-173065763 ATGTATTTATATAGTTGTGAGGG + Intergenic
983962846 4:173775601-173775623 ATGTATTTTTATGGTGTTCAGGG + Intergenic
984136719 4:175950307-175950329 ATTTTTTTACATTATTTTAATGG + Intronic
984172110 4:176371760-176371782 ATGTATTTATATAGTTTCCAAGG + Intergenic
984235182 4:177148086-177148108 ATGAATCTACATTTTTTTAAAGG - Intergenic
984266421 4:177502735-177502757 ATGTATTTGCATGGTTTTCAAGG + Intergenic
984330410 4:178308274-178308296 ACGTGTTTACATGGCTTTCAAGG - Intergenic
984527322 4:180873060-180873082 ATGTATTTGCATGGTTTTGAAGG + Intergenic
984671958 4:182499916-182499938 AAGTATTTATGTGATTTTAAGGG + Intronic
984721966 4:182981099-182981121 ATGTATTTGCATGGTTTTGTAGG - Intergenic
985008373 4:185557520-185557542 ATGTATTTGCATGGTTTTGAAGG + Intergenic
985093145 4:186384285-186384307 AGGTATTTGCATGGTTTTGAAGG - Intergenic
985240519 4:187926740-187926762 ATGTATTTGCATAGTTTCGAAGG + Intergenic
985355972 4:189119498-189119520 ATGTATTTATATGGTTTTGATGG - Intergenic
985417025 4:189745671-189745693 ATGTATTTGTATAGTTTTGATGG - Intergenic
985530433 5:430858-430880 ATGTATGTACCTTATTTTAAAGG + Intronic
986259238 5:6128669-6128691 ATGTATTTACATGATTTTCAGGG - Intergenic
986537289 5:8803844-8803866 ATGTATTTGTATGGTTTTGAGGG + Intergenic
986540049 5:8835371-8835393 ATACATCTACATGGATTTAATGG - Intergenic
986634273 5:9804592-9804614 ATGTATTTGCATGGTTTCGAGGG - Intergenic
986870458 5:12039177-12039199 ATGCATTTGCATGGTTTTGAGGG - Intergenic
987440414 5:17949305-17949327 ATGTATTTACATGATTTTGAGGG + Intergenic
987505076 5:18758524-18758546 ATTTATTTAGATGGCTTTACAGG - Intergenic
987563770 5:19557992-19558014 ATGTATTTGCATGGTTTTGAGGG - Intronic
987577963 5:19754860-19754882 ATGTATTTGCATGGGTTCAAAGG - Intronic
987596510 5:20007767-20007789 ATGTTTTTACATTTTTTAAATGG + Intronic
987600749 5:20066922-20066944 ATGTATTTACATGTTACTAGAGG - Intronic
987846491 5:23293915-23293937 ATGTATTTTCATGGTTTTGAGGG + Intergenic
988002425 5:25365580-25365602 ACATATTTGCATGGTTTTGAGGG - Intergenic
988420883 5:31004900-31004922 ATGCATTTGCATGGTTTTGAGGG + Intergenic
988623418 5:32846531-32846553 CTGAATTTACCTGGGTTTAAGGG - Intergenic
988882934 5:35523300-35523322 TTATATTTTTATGGTTTTAAGGG + Intergenic
988889745 5:35602063-35602085 ATGTATTTGTATAGTTTTGAGGG - Intergenic
988929524 5:36023120-36023142 ATGTTTTTGCATGGTTTTGAGGG + Intergenic
989355211 5:40536639-40536661 ATGTATTTGCATAGTCTTGAGGG + Intergenic
989437666 5:41433797-41433819 ATCAATTCACAAGGTTTTAATGG - Intronic
989460612 5:41694030-41694052 ATGTATTTGTATAGTTTTGAGGG + Intergenic
989461646 5:41706301-41706323 ATGTAATCATATGGTTTTGAGGG + Intergenic
989525636 5:42450921-42450943 ATGTATTTCTATAGTTTTGAAGG + Intronic
989533568 5:42537450-42537472 ATGTATTTGCATGGTTTTGACGG + Intronic
989685403 5:44080647-44080669 ATGTATTTAAATGGTTTATATGG + Intergenic
989694146 5:44179941-44179963 ATGTATTTGAATGGTTTTGAGGG + Intergenic
989949315 5:50279028-50279050 ATGTATTTATTTTATTTTAATGG - Intergenic
990104530 5:52241660-52241682 ATCTATTTAAATGCTTTTATTGG - Intergenic
990113283 5:52354845-52354867 ATGTATTCACAAGGTTGAAAAGG + Intergenic
990233578 5:53741697-53741719 ATGTATTTGCATGGTTTTGAAGG - Intergenic
990243781 5:53841589-53841611 ATGTATTTGCATGGTTTTGAAGG - Intergenic
990268430 5:54106193-54106215 ATGTATTAACATGGTTAGAGTGG + Intronic
990573060 5:57098333-57098355 ATGTATTTGCATGGTTTTGGAGG - Intergenic
990712591 5:58602141-58602163 ATGTATTTGCGTGGTTTTGAAGG + Intronic
990749455 5:58998169-58998191 CTATTTTTACATGTTTTTAAAGG + Intronic
990891521 5:60655908-60655930 ATGTCTTTGCATGGCTTTGAGGG + Intronic
990898805 5:60728392-60728414 ATGTATTTTCATGGTTTTGAAGG + Intergenic
990905321 5:60796719-60796741 TTTCATTTAAATGGTTTTAAAGG + Intronic
991048409 5:62246909-62246931 ATTTATTTTGCTGGTTTTAATGG + Intergenic
991387237 5:66103688-66103710 ATGTATTTGCATGGTTTTGAAGG - Intergenic
991924112 5:71686773-71686795 ATGTATTTGCATGGTTTTGAAGG - Intergenic
992239761 5:74755338-74755360 ATGTATTTGCATGATTTTGAGGG - Intronic
992339850 5:75812120-75812142 ATGTATTTGCATGGTTTTGAAGG + Intergenic
992404042 5:76439144-76439166 ATGTATTTGTATAGTTTTGAAGG + Intronic
992520390 5:77545018-77545040 ATGTATTTGCATGGTTTTGAAGG - Intronic
992599629 5:78385738-78385760 ATGTATTTTTATGGTTTTAAGGG + Intronic
992898871 5:81272779-81272801 ATGTATTTGCATCGTTTTGAGGG - Intergenic
993026767 5:82655738-82655760 ATATATTTATATGGTATTTACGG + Intergenic
993250102 5:85510909-85510931 ACATATTTACATGGTTTTGAAGG + Intergenic
993277599 5:85880690-85880712 ATGTATTTGCATGGTTTTGAAGG + Intergenic
993365780 5:87032504-87032526 ATGTATTTGTATAGTTTTAAGGG + Intergenic
993646377 5:90468776-90468798 ATATATTTGCATGGTTTTGAGGG - Intronic
993743507 5:91567376-91567398 ATGTATTTGCATGGTTTTGAAGG - Intergenic
993883646 5:93392394-93392416 ATGTATTTGCATGGTTTTGAAGG + Intergenic
993917295 5:93758592-93758614 ATGTATTTGCATGGTTTTGAAGG - Intronic
993948333 5:94141835-94141857 ATGTACTTGCATGGTTTTAAAGG + Intergenic
994051080 5:95363302-95363324 ATGTATTTGCATGGTTTTGAAGG + Intergenic
994207726 5:97054451-97054473 ATGTATTTATATAGTTTTCTGGG + Intergenic
994220614 5:97190886-97190908 ATGTATTTGCATGCTTGTGAGGG + Intergenic
994337842 5:98590045-98590067 AAGTATTCACATTTTTTTAATGG + Intergenic
994347438 5:98703371-98703393 ATGTATTTGCATCATTTTGAGGG - Intergenic
994398871 5:99254105-99254127 ACGTATTTGCATAGTTTTGAGGG + Intergenic
994416536 5:99478902-99478924 ATGTATTTACCTTTTTGTAAGGG - Intergenic
994496785 5:100522739-100522761 ATGTATTTGCATGGTTTTGAGGG - Intergenic
994527346 5:100923168-100923190 ATGTATTTTCATGGTTTTGAAGG + Intergenic
994593075 5:101796188-101796210 CAGTATTTACATGAGTTTAATGG - Intergenic
994823473 5:104681846-104681868 ATGTACTTGCATAGTTTTGAGGG - Intergenic
994875555 5:105416256-105416278 ATGTATTTTCATGGTTTTGAAGG - Intergenic
994980501 5:106869559-106869581 ATGTATTTTTAAAGTTTTAATGG + Intergenic
995091401 5:108182599-108182621 GTGTATTTTTATGTTTTTAATGG - Intronic
995096153 5:108238037-108238059 ATGTATTTACATCTTTTACAGGG + Intronic
995317674 5:110794930-110794952 ATGTATTTGCATGGTTTTGAAGG + Intergenic
995472763 5:112520915-112520937 ATGTATTTGCACAGTTTTGAAGG + Intergenic
995593792 5:113727531-113727553 ATGTAGTTGTATGGTTTTGAGGG + Intergenic
995693475 5:114853720-114853742 ATGTGTTTGCATGGTTTTGTAGG - Intergenic
995699651 5:114920057-114920079 ATGTATTTGCATGATTTTGAGGG - Intergenic
995818062 5:116194015-116194037 ATGTATTTGCATGGTTTTGAAGG - Intronic
996010854 5:118479801-118479823 ATGATTTTTCAGGGTTTTAAAGG - Intergenic
996010993 5:118481542-118481564 ATGTATTTGCATGGTTTTGAAGG - Intergenic
996025461 5:118640292-118640314 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
996032207 5:118718070-118718092 ATGTATTTGCATGGTTTTGAAGG - Intergenic
996174645 5:120340343-120340365 ATATACTTATATGGTTTTTAAGG + Intergenic
996279660 5:121713509-121713531 ATGTATTTTCTTGGTTTTAAGGG - Intergenic
996288702 5:121826711-121826733 ATGTATTTACATAGTTTTGAAGG + Intergenic
996326774 5:122284077-122284099 ATGTATTTGTATGGTTTTCAGGG + Intergenic
996427252 5:123327912-123327934 ATGTATTTGTATAGTTTTGAGGG + Intergenic
996495071 5:124146199-124146221 ACGTATTTTTATGGTTTTGAAGG + Intergenic
996657329 5:125956775-125956797 GTGTACTTGCATGGTTTTGAGGG - Intergenic
996835161 5:127783413-127783435 ATGTATTTGCATGATTTTGAAGG + Intergenic
996875148 5:128232727-128232749 ATGTATTTGCATGGTTTTGAGGG + Intergenic
997038922 5:130228199-130228221 AAGTATCTACATGATTTCAAGGG + Intergenic
997105732 5:131017366-131017388 ATGTATTTGCATGGTTTTGAAGG + Intergenic
997152467 5:131513085-131513107 ATGAAATTACAGGGTTTAAACGG + Intronic
997414860 5:133718840-133718862 TGGTATGTACATGGTTTCAATGG - Intergenic
997765338 5:136497666-136497688 ATGTATTTGCATGGTTTTGGAGG + Intergenic
997880445 5:137584295-137584317 ATGTATTTGTAGGGTTTTAGTGG - Intronic
998029192 5:138849852-138849874 GTGCATTTACATGGCTTAAAGGG + Intronic
998408831 5:141892271-141892293 ATATTTTTAAATGGTTGTAATGG + Intergenic
998708630 5:144794912-144794934 ATGTATTTGTATAGTTTTAAGGG + Intergenic
998741858 5:145212559-145212581 ATGTATTTGTATAGTTTTGAGGG - Intergenic
998793549 5:145792700-145792722 ATGTGTTTACATGAATTTGAGGG + Intronic
999490910 5:152050663-152050685 ATGTATTTGCATGGTTTTGAGGG + Intergenic
999599643 5:153247852-153247874 ATGTATTTGCATGGTTTTGAAGG + Intergenic
999801033 5:155036660-155036682 GTGTATTTGCATGGTTTTGAAGG + Intergenic
999839156 5:155405703-155405725 ATGTATTTGCATGGTTTTGAGGG - Intergenic
999913134 5:156227934-156227956 ATGTATTTGCATGGTTTTGAAGG + Intronic
1000158837 5:158579526-158579548 ACATATTTACATGGTTTTGAGGG + Intergenic
1000394877 5:160763410-160763432 ATGTATTTGTATAGTTTTGAAGG - Intronic
1000474342 5:161686652-161686674 ATGTATATTGATGGCTTTAATGG - Intronic
1000498052 5:162010595-162010617 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1000584659 5:163082268-163082290 ATCTATTTGCATGGTTTTGAAGG - Intergenic
1001166058 5:169368659-169368681 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1001189343 5:169613317-169613339 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1001263182 5:170250440-170250462 ATCTATTTAGATGGTGTCAAAGG - Intronic
1001478553 5:172068942-172068964 AGAAATTTACATGGTTGTAAAGG + Intronic
1001693537 5:173651604-173651626 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1001733525 5:173979102-173979124 ATGTATTTGCATGGTTTTGAGGG + Intronic
1002814103 6:662502-662524 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003063395 6:2880141-2880163 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1003297237 6:4841685-4841707 ATGTTTTTGCCTGGTTTTGAGGG + Intronic
1003451119 6:6232801-6232823 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003465189 6:6372945-6372967 GTGTATTTTCATGGTTTTGAGGG - Intergenic
1003582261 6:7350608-7350630 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003789627 6:9529522-9529544 TTGTATTTCCTTGATTTTAAGGG - Intergenic
1003930126 6:10916611-10916633 ATGTATTTGCATGGTTTTGAAGG + Intronic
1004030000 6:11859045-11859067 ATATATTTACATAGTTCCAAAGG - Intergenic
1004152022 6:13130002-13130024 ATGTATTTGTATAGTTTTAGGGG - Intronic
1004888770 6:20077284-20077306 ATGTATTTGCATGGTTTTGGGGG - Intergenic
1005038931 6:21584333-21584355 ATGTATTTGCATGGCTTTGAAGG + Intergenic
1005072743 6:21877041-21877063 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1005107577 6:22241304-22241326 ATGTATTTGCACGGTTTTTAGGG - Intergenic
1005193137 6:23251337-23251359 ACATATTTGCATGGTTCTAATGG + Intergenic
1005244330 6:23864519-23864541 ATGTATTTGCATGTTTTTGAGGG - Intergenic
1005259237 6:24040143-24040165 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1005262532 6:24076905-24076927 AGGTATTTATATAGTTTTGAGGG + Intergenic
1005305502 6:24510096-24510118 ATGTATTTGCATGGTTTTGAAGG + Intronic
1005435385 6:25805250-25805272 ATGTATTTGGATAGTTTTCATGG - Intronic
1005570170 6:27137589-27137611 ATGTATGTAAATCCTTTTAATGG - Intergenic
1005760581 6:28963939-28963961 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1005929545 6:30473458-30473480 ACGTATGTGCATGGTTTTGAGGG - Intergenic
1006062741 6:31437014-31437036 ATGTATTCACACAGTTTTGAGGG + Intergenic
1006199190 6:32271342-32271364 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
1006286500 6:33099322-33099344 ATGTATTTGTATAGTTTTGAAGG - Intergenic
1007215052 6:40230485-40230507 ATTTATTTCCATGGTTTGGAAGG + Intergenic
1007815328 6:44519936-44519958 ATGTATTTATATAGTTTCCAAGG + Intergenic
1007892960 6:45312986-45313008 ATGTATTTGCATGGTTTTGAGGG - Intronic
1008042054 6:46812759-46812781 ATGCATTTGCATGGTTTTGAGGG + Intronic
1008115759 6:47547873-47547895 ACGTATTTGCATGGTTTTCAAGG - Intronic
1008246860 6:49186600-49186622 TTTTATTTATAGGGTTTTAATGG - Intergenic
1008402107 6:51075871-51075893 ATGTATTTGCATGATTTTGAAGG + Intergenic
1008431426 6:51421868-51421890 ATGTATTTGCATGATTTTGAAGG - Intergenic
1008451980 6:51663062-51663084 AATTAATTACATGGTCTTAATGG + Intronic
1008528381 6:52431494-52431516 ATGTATTTGCATGGTTTTGAAGG + Intronic
1008706423 6:54165921-54165943 ATGTCTTTACATGGTGGAAAGGG - Intronic
1008766374 6:54921189-54921211 CTATATGTACATGGTTGTAAAGG - Intronic
1008775175 6:55029659-55029681 ATGTATTTGCATGGTTTTGGAGG + Intergenic
1008882746 6:56397659-56397681 ATATATTTGTATAGTTTTAAAGG - Intergenic
1008973337 6:57395947-57395969 ATGTATTTGCATGATTTTGAAGG + Intronic
1009162243 6:60297487-60297509 ATATATTTGCATGATTTTGAAGG + Intergenic
1009273536 6:61646071-61646093 ATCTATTCATAAGGTTTTAAAGG + Intergenic
1009360069 6:62800479-62800501 ATGTATTCGTATGGTTTTGAGGG + Intergenic
1009453467 6:63827937-63827959 ATGTATTTGCATGACTTTGAAGG - Intronic
1009589316 6:65645382-65645404 ATGTATTTGCATGGTTTTGAAGG - Intronic
1009800020 6:68525424-68525446 ATGTATTTTCATTATTTTGAGGG + Intergenic
1009881770 6:69576227-69576249 AAATATTTACATTGTTTTCAAGG - Intergenic
1009969079 6:70607343-70607365 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1010076127 6:71800970-71800992 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1010101723 6:72117623-72117645 ATGTATTTCTATAGTTTTGAGGG - Intronic
1010102713 6:72128238-72128260 ATGTATGTACATCTTTTTTAAGG - Intronic
1010120235 6:72366886-72366908 ATGTATTTACTAAGTTATAAGGG + Intronic
1010164861 6:72903623-72903645 ATGTATTTGCATGGTTTTGAAGG + Intronic
1010186435 6:73149336-73149358 ATATGTATACCTGGTTTTAAAGG + Intronic
1010270622 6:73912457-73912479 ATGTATTTATATAGTTTCTAAGG - Intergenic
1010479636 6:76335659-76335681 ATGTATTTGCATGATTTTGAGGG + Intergenic
1010518135 6:76800108-76800130 ATGTATTTTCATGGTTTTGAGGG + Intergenic
1010633459 6:78228634-78228656 ATGTATTTGCATGATTTTGAAGG + Intergenic
1010707495 6:79132433-79132455 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1010880044 6:81155914-81155936 ATGTATTTATATAGTTTTGAGGG - Intergenic
1011093270 6:83631133-83631155 ATGTATTTGCATGGTTTTGGAGG + Intronic
1011132887 6:84070386-84070408 ATGTATTTGCATGGTTTTGAAGG + Intronic
1011156416 6:84338437-84338459 ATGTATTTGTAAGGTTTTGAGGG + Intergenic
1011225412 6:85099740-85099762 ATGTATTTTCATGGTTTTGAGGG - Intergenic
1011319736 6:86078096-86078118 ATGTATTTGCAGGGTTTTGAAGG + Intergenic
1011320976 6:86093015-86093037 ATGCATTTGCATGGTTTTAAGGG + Intergenic
1011327385 6:86164295-86164317 ATGTGTTTTCATGGTTTTGAAGG - Intergenic
1011384230 6:86777102-86777124 AAGTATTTACATTTTATTAATGG + Intergenic
1011564542 6:88661015-88661037 ATGTATTTGTATGGTTTGGAGGG - Intronic
1011619905 6:89233316-89233338 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1011789483 6:90883085-90883107 ATGTGTTTGTATGGTTTCAAAGG + Intergenic
1011817340 6:91208288-91208310 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1011893063 6:92191668-92191690 AAGTGTTTGCATGGTTTTGAAGG + Intergenic
1011929771 6:92696980-92697002 ATTTATTTTCATGCTTTTAGTGG + Intergenic
1012038144 6:94169502-94169524 ATGTACTTGAATGGTTTTGAGGG - Intergenic
1012132217 6:95511024-95511046 ATGTATCTTCAGGATTTTAAAGG + Intergenic
1012156203 6:95822385-95822407 CTGTATTTGCATGGTTTTGGAGG - Intergenic
1012183474 6:96184745-96184767 ATTTATTTGCATGGTTTTGAAGG + Intronic
1012208139 6:96487037-96487059 TGATATTTACATGATTTTAAAGG + Intergenic
1012299009 6:97561294-97561316 ATGTATTTGCATGGTTTTGTGGG + Intergenic
1012302758 6:97610093-97610115 ATGTATTTGCATGGTTTTGTGGG + Intergenic
1012492784 6:99800750-99800772 ATGAAATTAGTTGGTTTTAAGGG - Intergenic
1012559040 6:100556048-100556070 ATAAATATATATGGTTTTAAAGG - Intronic
1012738061 6:102976184-102976206 ATGTATTTGCAGGGTTTTGAAGG - Intergenic
1012786445 6:103634300-103634322 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1012911658 6:105124522-105124544 ATGTTTTCACATGATTTTTAAGG - Intronic
1012965876 6:105672268-105672290 ATGTATTTCTATAGTTTTGAGGG - Intergenic
1013852403 6:114532228-114532250 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1013856941 6:114584062-114584084 ATGTATTTTCATGGTTTTGAGGG - Intergenic
1013900761 6:115153783-115153805 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1013940813 6:115659557-115659579 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1013985309 6:116185155-116185177 ATGTATTTGCATGATTTTGAGGG + Intronic
1014174469 6:118316378-118316400 AGGTATTTAATTGGTTTAAAAGG - Exonic
1014278379 6:119414029-119414051 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1014337066 6:120149886-120149908 ATGTATTTGCATGGTTTTCAAGG - Intergenic
1014420076 6:121233000-121233022 ATGTATTTGCATGGTTTTGAGGG + Intronic
1014421248 6:121248167-121248189 ATGTATTTGTATAGTTTTGAGGG - Intronic
1014481822 6:121948576-121948598 ATATATTTGCATGGTTTTGAGGG + Intergenic
1014531156 6:122561333-122561355 ATGTATTTGCATGGTTCTGAAGG + Intronic
1014591849 6:123283164-123283186 ATGTATTTTTATAGTTTTGAAGG - Intronic
1015084367 6:129270829-129270851 ATTTATTTACATGGGATAAAAGG - Intronic
1015196615 6:130530383-130530405 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1015222391 6:130819115-130819137 ACGTATTTGTATGGTTTTGAAGG - Intergenic
1015362137 6:132352425-132352447 ATGTATTTGCATAGTTTTGAAGG + Intronic
1015445135 6:133295062-133295084 ATATATTTAAATGTTTTAAATGG + Intronic
1015481399 6:133714837-133714859 ATGTACTTCCTAGGTTTTAAGGG + Intergenic
1015565818 6:134569747-134569769 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1015644035 6:135367069-135367091 ATGTATTTACATGGTTTTGAGGG + Intronic
1015663070 6:135598028-135598050 ATGTATTTACATGGTTTTGAAGG + Intergenic
1015849466 6:137557110-137557132 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1015864963 6:137718680-137718702 ATGTAATTACATGGGTCTCAAGG - Intergenic
1015877730 6:137840659-137840681 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1015900091 6:138055805-138055827 ATGCATTTGCATGATTTTGAGGG - Intergenic
1016079761 6:139841601-139841623 ATGTATATACATAGATTTTATGG - Intergenic
1016289726 6:142515903-142515925 ATGTATTTGCATGGTTTTCAAGG + Intergenic
1016351466 6:143173678-143173700 ATATATTTGCATGGTTTTGAGGG + Intronic
1016484816 6:144525975-144525997 ATATATTTGCATGGTTTTGAGGG + Intronic
1016498943 6:144695952-144695974 CTTTATTAACATGGTTTCAAAGG + Intronic
1016517778 6:144914798-144914820 ATGTATGTACATACATTTAATGG + Intergenic
1016615931 6:146048443-146048465 ATATGTTTTAATGGTTTTAATGG - Intronic
1016911810 6:149206892-149206914 ATGTATTTACTTGCTTTCCATGG + Intergenic
1017214705 6:151896973-151896995 ATGTATTTGCATGTTTTGGAAGG + Intronic
1017258543 6:152361946-152361968 ATGGATCTACATGGTTTTCCTGG + Intronic
1017535071 6:155338627-155338649 ATGTATTTGCATTGTTTTGAAGG + Intergenic
1017556081 6:155570543-155570565 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1018009645 6:159658142-159658164 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1018168511 6:161124519-161124541 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1018353039 6:162982595-162982617 ATGTATTTGTATGGTTTTGAGGG + Intronic
1018450955 6:163906981-163907003 ATGTATTTACAAGGTCATCATGG - Intergenic
1018665873 6:166137520-166137542 ATGTATTTGCAGGGTTTTGAAGG - Intergenic
1018668483 6:166161112-166161134 GTCTATTTACATGGTTATCAGGG + Intronic
1018781548 6:167071796-167071818 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1019015180 6:168875140-168875162 ATGAATTTAAAGGGTTTTCAAGG - Intergenic
1019375649 7:690657-690679 ATTTATTTAGGTGGTTTTAGTGG - Intronic
1020019833 7:4857656-4857678 ATGTACTTACATTGTTCTGAAGG - Intronic
1020348814 7:7195465-7195487 ATGTATTTACATGGTTTTGAGGG + Intronic
1020373987 7:7464510-7464532 ATGTATTTGCATGGCTTTGAAGG - Intronic
1020450092 7:8311608-8311630 AGGTATTTGCATAGTTTTGAGGG + Intergenic
1020455624 7:8371120-8371142 ATGTATTTACGTGGTTTTGAGGG + Intergenic
1020471751 7:8544841-8544863 ATGTATTTACATTTTCTAAAGGG - Intronic
1020635144 7:10687403-10687425 ATGTATTTGCAGGGTTTTGAAGG - Intergenic
1020675178 7:11174796-11174818 ATGATTTCACATTGTTTTAATGG + Intergenic
1020861032 7:13491949-13491971 ATGTATTTGCATGATTTTGAAGG - Intergenic
1020862548 7:13512899-13512921 ACGTAATTGCATGGTTTTGAGGG - Intergenic
1020866643 7:13572456-13572478 ATGTATTTGCTTGGTTTTTAGGG + Intergenic
1020995679 7:15260863-15260885 ATGTATTTGCGTGGTTTTGAGGG - Intronic
1021204531 7:17764244-17764266 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1021257447 7:18410685-18410707 ATGTATTTCCTTATTTTTAAAGG + Intronic
1021323282 7:19238113-19238135 ATGTATTTGCATAGTTTTGAGGG + Intergenic
1021340044 7:19454093-19454115 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1021398246 7:20177930-20177952 ATGTTTTTAAATGATTTTAAAGG - Intronic
1021473854 7:21037992-21038014 ACGTATTTGCTTGGTTTTGAAGG + Intergenic
1021635364 7:22687092-22687114 ATATATTTACATGCGTTTCATGG - Intergenic
1021693945 7:23257971-23257993 ATTTTTATACATTGTTTTAATGG + Intronic
1021769878 7:23988141-23988163 ATGTATTTATATAGTTTTGAGGG - Intergenic
1022125482 7:27352279-27352301 ATGTGTTTATTTGGGTTTAATGG + Intergenic
1022295585 7:29048873-29048895 ATGTATTCACATGGTTTCGAAGG - Intronic
1022933474 7:35147457-35147479 ATATATTTACATTTTTTTAGAGG + Intergenic
1023537505 7:41229033-41229055 ATGGATTTCCATGGTTTTGAGGG + Intergenic
1023653357 7:42393307-42393329 ATGTTCTTGCATGGTTTTATCGG + Intergenic
1023657403 7:42438511-42438533 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1023692718 7:42808250-42808272 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1023701511 7:42895950-42895972 ATGTATTTGCATGGGTTTGGAGG - Intergenic
1023748677 7:43348802-43348824 ATGTATTTGCATGGTTTTAAAGG + Intronic
1024174972 7:46830027-46830049 ATGAATTTGCATGGTTTTGAGGG - Intergenic
1024367076 7:48533289-48533311 ATGTATTTGCATGGTTTTGAGGG + Intronic
1024413308 7:49072859-49072881 ATGTGTTTATATATTTTTAAAGG - Intergenic
1024444807 7:49464959-49464981 ATTTATTTATATGTTTTTTAGGG + Intergenic
1024455984 7:49607416-49607438 ATGTATTTACATGGTTTTGAGGG - Intergenic
1024665334 7:51541339-51541361 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024669053 7:51575088-51575110 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024720526 7:52132483-52132505 ATTTATTTACATTTTTTTTATGG + Intergenic
1024745124 7:52397538-52397560 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024847581 7:53665879-53665901 ATATATTTTCATGGTGTTGAAGG + Intergenic
1024875992 7:54024140-54024162 ATGTATTTGCATGTTTTTGAGGG + Intergenic
1024916979 7:54512839-54512861 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024917832 7:54523975-54523997 ATGTATTTGCATGGATTTGAAGG + Intergenic
1024946925 7:54817754-54817776 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1025771963 7:64516814-64516836 ATGTATTTGAATGGTTTTAAAGG - Intergenic
1025773102 7:64531639-64531661 ATGTATTTGCATGGTTTTGAAGG - Intronic
1025794561 7:64726940-64726962 ATGTATTTGCATGATTTTGAAGG + Intergenic
1027295667 7:76766883-76766905 ATGTATTTACATGGTTGTGAAGG - Intergenic
1027328744 7:77068978-77069000 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1027350167 7:77303775-77303797 ATGTATTTGCATGGTTTTGAAGG + Intronic
1027562963 7:79755415-79755437 ATGTATTTACATGGTTTTGTGGG + Intergenic
1027693435 7:81376955-81376977 ACGTATTTGCATGGTTTTGAGGG + Intergenic
1027878269 7:83799807-83799829 ATGTCTTTGCAGGGTTTTGAGGG + Intergenic
1027967605 7:85032986-85033008 ATGTGTTTACATATTTTTAAAGG + Intronic
1028026070 7:85842132-85842154 ATGTATTTATATACATTTAAGGG + Intergenic
1028028477 7:85877230-85877252 ACGTAATTGCATGGTTTTCAGGG - Intergenic
1028182776 7:87746093-87746115 ATGTACTTGCATGGTTTTGAAGG + Intronic
1028198026 7:87929600-87929622 ATGTTATTGCATGGTTTTGAGGG - Intergenic
1028261899 7:88676638-88676660 ATGTATTTATATGATTTTGAGGG - Intergenic
1028309548 7:89313938-89313960 ATGTCTTTAGATTTTTTTAAAGG - Intronic
1028346020 7:89783802-89783824 ATGTAATTGCATGGTTTTGACGG + Intergenic
1028402144 7:90435332-90435354 ATGTATTTACATAGTTTTGAGGG - Intronic
1028502114 7:91530358-91530380 ATGTATTTGCATGGTTTTTGAGG - Intergenic
1028783109 7:94759801-94759823 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1028818536 7:95178231-95178253 ATGTATTTGCATGGTTTTGAAGG - Intronic
1028822768 7:95231594-95231616 ATGTATTTGCATTGTTTTGAGGG - Intronic
1028936632 7:96472029-96472051 GTGTATTTGCGTGGTTTTGAGGG + Intergenic
1028993223 7:97072756-97072778 ATGTATTTGCATTGTTTTGAAGG + Intergenic
1029787027 7:102802389-102802411 ATGTATTTGCATGGTTTTGAAGG - Intronic
1029829403 7:103240228-103240250 ATATATTTACATTTTTTTAGAGG + Intergenic
1030390211 7:108918631-108918653 ATATATTTGCATGGTTTTGAAGG + Intergenic
1030456093 7:109775656-109775678 ATGTGTTTGCATGGTTTTGAGGG - Intergenic
1030585573 7:111414353-111414375 ATGTCTTTCCATGGCTTTATAGG - Intronic
1030972551 7:116078125-116078147 ATGTATTTGCGTGGTTTTGAGGG - Intronic
1031148036 7:118018979-118019001 ACATATTTGCATGGTTTTGAAGG - Intergenic
1031220136 7:118955195-118955217 ATGTATTTGCATAGTTTTGAGGG + Intergenic
1031673245 7:124578066-124578088 CTGCATTTTCATGGTTTTATTGG + Intergenic
1031724221 7:125216933-125216955 ATGTATTTAGGTGGTTTTGATGG - Intergenic
1031761022 7:125713609-125713631 ATGTATTTGCATGGCTCTGAAGG + Intergenic
1031858599 7:126952251-126952273 ATATATTTATTTGGTTTTATGGG - Intronic
1031879460 7:127179697-127179719 ATGCATTTGCATGGTTCTGAAGG - Intronic
1032229290 7:130060275-130060297 ATGTATTTTTTTGGTTTTTATGG + Intergenic
1032288938 7:130568909-130568931 ATGTATTTGCCTGGTTTTCAAGG - Intronic
1032289527 7:130576416-130576438 ATGTATTTGCACGGTTTTGAAGG - Intronic
1032654366 7:133911597-133911619 ATTTACTTACATATTTTTAAAGG - Intronic
1032916802 7:136499612-136499634 ATGTATTCACATTGCTTTAGCGG - Intergenic
1033022770 7:137743479-137743501 ATATATTTTTATGGTTTTGAAGG - Intronic
1033027060 7:137784822-137784844 ATGTGCTTATATGGTTTTGAGGG - Intronic
1033517108 7:142117961-142117983 ATGTATTTCCATGGGTTGAAAGG + Intronic
1033623127 7:143080423-143080445 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1033665159 7:143434021-143434043 ACGTATTTCCATGGCTTTATCGG - Intergenic
1034115449 7:148579758-148579780 CTATATTGACATGCTTTTAATGG + Intergenic
1034229907 7:149515275-149515297 ATGTTTTTGCATGGTTTTGAAGG + Intergenic
1034705270 7:153137145-153137167 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1035151456 7:156876668-156876690 ATGTATTTGTCTGGTTTTGAAGG - Intronic
1035228620 7:157447354-157447376 ATATTTTTAAATGGTTTAAATGG - Intergenic
1036035575 8:5014941-5014963 ATTTGTTTAGGTGGTTTTAAAGG - Intergenic
1036518211 8:9465841-9465863 ATATATTTTCATAGGTTTAAAGG - Intergenic
1036771359 8:11580448-11580470 AGTTATTTGCATTGTTTTAAAGG + Intergenic
1037141330 8:15523629-15523651 ATATATATATATGTTTTTAAAGG - Intronic
1037236201 8:16721852-16721874 ATGTCTTTACATGGTCTGAGAGG + Intergenic
1037276059 8:17180022-17180044 GTGTATTTAGATGGTATGAATGG + Intronic
1038233312 8:25726549-25726571 ATGTAATTGTATGGTTTTGAGGG + Intergenic
1038237311 8:25771889-25771911 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1038828187 8:31030711-31030733 AAGTGTTGACATGGTTTTAAGGG + Intronic
1039000817 8:32978259-32978281 ATGTACTTGCATTGTTTTGAGGG - Intergenic
1039030329 8:33302028-33302050 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1039042481 8:33421489-33421511 ATGGATTCAAAAGGTTTTAATGG + Intronic
1039095320 8:33878463-33878485 ATGTGTTTGCATGGTTTTGAAGG + Intergenic
1039123821 8:34178051-34178073 ATGTATTTACAGAGTTTTGAAGG - Intergenic
1039358328 8:36846102-36846124 ATGCATTTGCCTGCTTTTAAAGG - Intronic
1039642587 8:39240274-39240296 ATGTATTTGGATGGTTTTGAGGG - Intronic
1039653392 8:39370472-39370494 ATATATTTGCATGGTTTTGAGGG - Intergenic
1039748252 8:40452518-40452540 ATGTGTTTGCATGGTTTTGAAGG + Intergenic
1039810270 8:41041604-41041626 ATGTATTTGCATGGTTTCAAAGG + Intergenic
1040433803 8:47369962-47369984 ATTTCTTTACATTGTGTTAAAGG - Intronic
1040442595 8:47459928-47459950 ATGTATTTGCATGGTTTTGAAGG + Intronic
1040529090 8:48251098-48251120 ATATATTTGCATAGTTTTGATGG + Intergenic
1040670877 8:49688999-49689021 ATGTATTTGTATGGTTTTGAGGG + Intergenic
1040704625 8:50110639-50110661 ATATGTTTACCTGGATTTAAAGG - Intronic
1040800487 8:51334167-51334189 ATGTATTTCCATGGTTTTGAGGG - Intronic
1040809558 8:51436559-51436581 ATGTATTTGCATGGTTTTGAGGG - Intronic
1040993489 8:53377231-53377253 ATGTATATATTTTGTTTTAAAGG - Intergenic
1041112514 8:54497867-54497889 ATGTATTTGCATGGTTTTGACGG + Intergenic
1041150545 8:54928273-54928295 GTGTATTTGCATGGTTTTGAGGG - Intergenic
1041228015 8:55719571-55719593 ATGTATTTGCATGATTTTGAAGG - Intronic
1041293423 8:56330500-56330522 ATGTTTTTACATGGTTTTGAAGG + Intergenic
1041436584 8:57848500-57848522 ATGCGTTTACAGGGTTTCAAAGG - Intergenic
1041570302 8:59330690-59330712 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1041637359 8:60158926-60158948 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1041832249 8:62167392-62167414 ATGTATTTGCATGGCTTTGAAGG - Intergenic
1041859692 8:62498923-62498945 ATATAAATAAATGGTTTTAAGGG - Intronic
1041877732 8:62710014-62710036 ATGTATTTGCATTGTTTTGAAGG + Intronic
1042022525 8:64382878-64382900 ATGTATTGCAAAGGTTTTAAGGG - Intergenic
1042122579 8:65504667-65504689 ATGTATTTTAATAGTTTTGAGGG + Intergenic
1042570179 8:70155525-70155547 ATGAATTTACATTTTTTTAATGG + Intronic
1042704538 8:71652276-71652298 ATTCATTTACATGGTTTAAAAGG + Intergenic
1042821371 8:72933735-72933757 ATAGATTCAGATGGTTTTAAAGG - Intronic
1042875544 8:73437633-73437655 ATGAATATACATCTTTTTAAGGG + Intronic
1042995748 8:74696170-74696192 ATGTATTTGCATGGTTTTGAGGG - Intronic
1043048909 8:75360852-75360874 ATGTATATGCATGGTTTTGAAGG - Intergenic
1043104092 8:76085938-76085960 ATGTATTTATATAGCTTTGAGGG + Intergenic
1043121437 8:76330303-76330325 ATGTATTTGTATGGTTTTGAAGG + Intergenic
1043172969 8:76988456-76988478 AGGTATGTACATTGTTTTTAAGG - Intronic
1043222016 8:77678172-77678194 ATTTATTTACTTATTTTTAATGG - Intergenic
1043362818 8:79495628-79495650 ATGTATTCGGATGGTTTTGAGGG + Intergenic
1043568581 8:81575246-81575268 ATGTATTTGAATGGTTTTGAAGG + Intergenic
1043679130 8:82999492-82999514 ATGTCTTTGCATGGTTTTGAGGG - Intergenic
1043763991 8:84105799-84105821 ATGTATTTATCTGGGTTTAGTGG - Intergenic
1043803232 8:84638158-84638180 ATGTATTTGCATAGTTTTGAAGG - Intronic
1043876137 8:85488830-85488852 ATGTATTTGCGTGGTTTTGATGG + Intergenic
1043965986 8:86476459-86476481 ATATATTTCAATGGTTTTTATGG + Intronic
1043985606 8:86692018-86692040 ATGTATTTGCATGGCTTCGAGGG + Intronic
1043988116 8:86717861-86717883 GTGTGTTTGCATGGTTTCAAGGG - Intronic
1044292112 8:90484690-90484712 ATGTATTTGCTTGGTTTTGAGGG - Intergenic
1044657105 8:94560159-94560181 ACGTATTTGTATAGTTTTAAGGG + Intergenic
1044788018 8:95816719-95816741 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1044903562 8:96974712-96974734 ATGTATTTACATGGTTTTAAGGG - Intronic
1044907476 8:97020075-97020097 ATGTATTTGCCTGGTTTTGAAGG - Intronic
1044947648 8:97405651-97405673 ATGTATTTGTATGGTTTTGAGGG + Intergenic
1045122018 8:99048141-99048163 ATGTATTTGCATGGTTTTGAAGG + Intronic
1045577965 8:103446489-103446511 ATCTATTTAAATAATTTTAAGGG - Intergenic
1045780067 8:105852241-105852263 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1045814060 8:106259085-106259107 ATGTTTTTGCATGATTTTTAGGG + Intergenic
1045881230 8:107043174-107043196 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1046031972 8:108793185-108793207 ATCTAAATACATGGTTTTATTGG + Intergenic
1046317543 8:112525731-112525753 ATGTATATATATGGTTTTTGGGG - Intronic
1046369344 8:113280948-113280970 ATGTATTTGCATGGTATTGAGGG + Intronic
1047032606 8:120898791-120898813 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1047166743 8:122447721-122447743 TTGTATTTACATGGTTTCCTGGG - Intergenic
1047182346 8:122601390-122601412 ACGTTTTTAAATGGTTATAAAGG + Intergenic
1047530879 8:125674154-125674176 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1047798197 8:128279830-128279852 ATGTATTTGCATGGCTTTGAGGG - Intergenic
1047840070 8:128742001-128742023 ATGTATTGAAATTTTTTTAAAGG - Intergenic
1047890218 8:129300512-129300534 ATGTATATGCATGGTTTTGAGGG + Intergenic
1047937189 8:129794032-129794054 ATGCATTTGCATGGTTTTGAGGG + Intergenic
1048371451 8:133781374-133781396 ATGTATTTGTATGGTTTTGAGGG + Intergenic
1048393721 8:133992765-133992787 ATTTATTTACATTTTTTAAAAGG - Intergenic
1048712902 8:137232046-137232068 ATATAGTTACATTGATTTAAAGG + Intergenic
1048776214 8:137949430-137949452 ACATATTTACTGGGTTTTAAAGG - Intergenic
1048837132 8:138530653-138530675 ATGTATTTACTTGGTCTCAAAGG + Intergenic
1049869495 8:144962948-144962970 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1049897859 9:126971-126993 ATGTATCGGCATGGTTTTGAAGG + Intronic
1050147628 9:2586047-2586069 ATGTATTTACATGGTTTTGACGG - Intergenic
1050428791 9:5540091-5540113 ATGTAATTGCATGGTTTTGAAGG - Intronic
1050476052 9:6042158-6042180 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1050502945 9:6317708-6317730 ATGTATTTGCGTGGGTTTGAGGG - Intergenic
1050749800 9:8923563-8923585 TTGTGTTTACATTGTTTTTATGG + Intronic
1051277647 9:15412757-15412779 ATGTATTTGGATGGTTTTGAAGG + Intergenic
1051346065 9:16152231-16152253 ATGCATTTATATTGTTTTCAAGG + Intergenic
1051362932 9:16297295-16297317 ATGTATTTGCATGGCTTTGAAGG - Intergenic
1051601126 9:18875541-18875563 ATGTATTTGCATGGTTTTGAAGG + Intronic
1051687432 9:19672827-19672849 ATGTATTTGCATGGTTTTGAGGG + Intronic
1051696713 9:19775602-19775624 ATGGATTTATATGTATTTAATGG + Intronic
1051733435 9:20172062-20172084 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1051816718 9:21117038-21117060 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1052141295 9:24988439-24988461 ATGTATTTGTATGGTTTGGAAGG + Intergenic
1052212154 9:25917654-25917676 CTGTATTTCCATGTTTTTACTGG + Intergenic
1052247202 9:26350148-26350170 CTGTATTTGCATGATTTTGAAGG - Intergenic
1052253792 9:26429547-26429569 ATGTATTTTCTTGGTTTTGAGGG - Intergenic
1052257338 9:26473607-26473629 ATGCATTTACTTTATTTTAAAGG - Intergenic
1052307468 9:27026671-27026693 ATGTATCTGCATGGTTTTTAAGG - Intronic
1052383638 9:27799352-27799374 CTGTATTAACATGTCTTTAAAGG + Intergenic
1052564810 9:30135861-30135883 ATGTATTTACATGGTTTTGAGGG - Intergenic
1052624675 9:30959992-30960014 ATATATTTTCATGGTTTTGAAGG + Intergenic
1053107104 9:35419538-35419560 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1053740941 9:41137264-41137286 ATGTATCTGCATGGTTTTGAAGG + Intronic
1054318161 9:63621406-63621428 AAGCATTTTCATGGGTTTAAAGG + Intergenic
1054443929 9:65293406-65293428 ATGTATCTGCATGGTTTTGAAGG + Intergenic
1054486344 9:65728100-65728122 ATGTATCTGCATGGTTTTGAAGG - Intronic
1054687409 9:68294033-68294055 ATGTATCTGCATGGTTTTGAAGG - Intronic
1054821553 9:69526393-69526415 ATGTCTTTTCCTCGTTTTAATGG - Intronic
1054844570 9:69779972-69779994 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1055104044 9:72493975-72493997 ATGCATTCACATGGCTTTCATGG + Intergenic
1055138141 9:72846769-72846791 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1055244837 9:74227144-74227166 ATGTATTAGCAGGGTTTTCAGGG - Intergenic
1055656629 9:78456464-78456486 ATGTATTTGCACGGTTTTGAAGG - Intergenic
1055838030 9:80467983-80468005 ATCTATTTCAATGGTTTTGAGGG + Intergenic
1056309672 9:85326872-85326894 ATGTATTTGTATGGTTTTGAGGG - Intergenic
1056322492 9:85449678-85449700 ATGTATTTGCATGATTTTGAAGG + Intergenic
1056396930 9:86190048-86190070 ATGTACTTGCATGGTTGTGAGGG - Intergenic
1056484141 9:87037293-87037315 ATTTATTTACATATTTTCAAAGG - Intergenic
1056582407 9:87901280-87901302 ATATATTTGCATGGTTTTGAGGG - Intergenic
1056671834 9:88636331-88636353 ATGTATTTGCATAGTTTTGAGGG + Intergenic
1056920784 9:90786860-90786882 ATTGATTTACAAAGTTTTAATGG - Intergenic
1057475949 9:95401860-95401882 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1057643109 9:96847037-96847059 ATGTATTTTTATAGTTTTAAAGG - Intronic
1058084806 9:100737360-100737382 ACGTATTTGCATGATTTTAAAGG + Intergenic
1058156496 9:101522005-101522027 ATGTATTTGCATTGTTTCAAAGG + Intronic
1058193629 9:101948289-101948311 ATGTATTTATGTATTTTTAAAGG + Intergenic
1058233790 9:102463882-102463904 ATATGTTTGCATGGTTTTGAGGG - Intergenic
1058275973 9:103041674-103041696 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1058622956 9:106903219-106903241 ATGTATTTTCATGGTTTGGAAGG + Intronic
1059022050 9:110586844-110586866 ATGTATTTGCATGGTTATGAAGG + Intergenic
1059032914 9:110719939-110719961 ATGTATTTTCATGGTTTTGAGGG - Intronic
1059609344 9:115875906-115875928 ATATATTTGCATGGTTTTGAAGG + Intergenic
1059674005 9:116519355-116519377 ATGTATTTGCATGGTTTTGAGGG - Intronic
1060015368 9:120081980-120082002 ATGTATTCACAGGGTGTTGAGGG + Intergenic
1060082934 9:120669197-120669219 ATGTATATACTATGTTTTAAGGG + Intronic
1060670288 9:125462722-125462744 ATTCACTTACATGTTTTTAATGG - Intronic
1062705644 9:137939413-137939435 ATGTATTTGCATGGTTTTGAGGG - Intronic
1202785194 9_KI270719v1_random:8098-8120 AAGCATTTTCATGGGTTTAAAGG + Intergenic
1203636119 Un_KI270750v1:113980-114002 ATGTATTTGTATAGTTTTGATGG + Intergenic
1186308658 X:8292661-8292683 ATGTATTTCCATGGATTGGAGGG - Intergenic
1187218964 X:17305399-17305421 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1187681625 X:21773010-21773032 ATGTATTTCCATGGTTTTGAAGG - Intergenic
1187695917 X:21920047-21920069 CCGTATTTGCATGGTTTTTAGGG + Intergenic
1187748947 X:22440257-22440279 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1187751963 X:22476514-22476536 ATATTTTTGCATGGTTTTGACGG + Intergenic
1188153347 X:26707843-26707865 ATGTATGTACATGAGTTTTATGG - Intergenic
1188389129 X:29598318-29598340 ATGTATTTGCATGGTTTTGAGGG + Intronic
1188639863 X:32487689-32487711 ATGTGTTTATGTGGTTATAATGG + Intronic
1189034458 X:37481500-37481522 ATATATATATATAGTTTTAAAGG + Intronic
1189218418 X:39347460-39347482 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1189518961 X:41745316-41745338 ATCTATTAACATGGGTTTATAGG - Intronic
1189567434 X:42257558-42257580 ATGAATTTGCATGGTTTTGAGGG - Intergenic
1189604040 X:42657089-42657111 ATGTATTTGTATGGTTTCAAAGG - Intergenic
1189639086 X:43048318-43048340 ATGTATTTGTATAGTTTTGAAGG + Intergenic
1189650177 X:43180361-43180383 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1189878909 X:45468767-45468789 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1189931956 X:46021949-46021971 ATGTATTTACATGGTTTTGAAGG - Intergenic
1189962287 X:46335388-46335410 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1190472563 X:50797607-50797629 ATGTAGTTATGTGGTTTAAAAGG - Intronic
1190502614 X:51094959-51094981 ATGTATTTCTGTGGTTTTGAGGG - Intergenic
1190631955 X:52396478-52396500 ATGTATTTGCATGATTTTGAAGG + Intergenic
1190897036 X:54630546-54630568 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1191045548 X:56132334-56132356 ATGTATTTTCATGGTCTTGAAGG - Intergenic
1191065720 X:56345094-56345116 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1191067463 X:56365718-56365740 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1191100502 X:56721743-56721765 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1191163730 X:57364846-57364868 ATGTAATTATGTGGTTTTGAGGG + Intronic
1191661271 X:63653763-63653785 ATTTGTTTAAATGGTTATAATGG + Intronic
1191778229 X:64841915-64841937 ATGTATTTGCACGGTTTTGAGGG + Intergenic
1191787413 X:64931644-64931666 ATGTATTTCTATAGTTTTGAGGG + Intronic
1191806819 X:65144765-65144787 ATGTATTTGTATGGTTTTGGAGG + Intergenic
1191812547 X:65204684-65204706 AGGTATTTTCCTGGTTATAAAGG + Intergenic
1191813820 X:65221048-65221070 ATGTATTTGCATGGTATTGAGGG - Intergenic
1191819986 X:65295253-65295275 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1191888665 X:65917865-65917887 GTGTATTTGCATGGTTTTGAGGG + Intergenic
1191906051 X:66091556-66091578 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1191909167 X:66129297-66129319 ATGTATTTGCATGATTTTGACGG + Intergenic
1191950893 X:66591354-66591376 ACGTATTTGCATGGTTTTGAAGG + Intergenic
1191954397 X:66628034-66628056 ATGTATCTGCATGGTTTTGAAGG - Intronic
1191965014 X:66748455-66748477 ATTTATTTGCATGGTTTTGACGG + Intergenic
1191970710 X:66812948-66812970 GTGTATTTGCATGGTTATGAGGG + Intergenic
1191994309 X:67074640-67074662 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1192164202 X:68815419-68815441 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1192298281 X:69873094-69873116 ATGTATTTGCATGGTTTTGAGGG - Intronic
1192609936 X:72557421-72557443 ATGTATTTGCATGGTTTTGAGGG - Intronic
1192671844 X:73152837-73152859 ATGTATTTGGATGGTTTTGAAGG + Intergenic
1192673792 X:73173353-73173375 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1192691023 X:73364469-73364491 ACATATTTGCATGGTTTTGAGGG + Intergenic
1192820474 X:74639512-74639534 ATATATTTGCATGGTTTTGAAGG - Intergenic
1192869162 X:75169566-75169588 ATATATTGGCATGGTTTTGAGGG + Intergenic
1192876847 X:75238813-75238835 ATGTATTTGTATACTTTTAAGGG - Intergenic
1192878366 X:75256212-75256234 ATGTATTTGCATAGTTTTGAAGG - Intergenic
1192880865 X:75282565-75282587 ATGTATTTGCATGATTTTGAAGG + Intronic
1192885398 X:75332104-75332126 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1192895266 X:75436627-75436649 ATGTATTCACATGGTTTTGAAGG + Intronic
1192904081 X:75531413-75531435 ATGTATTTGTATAGTTTTCAGGG + Intergenic
1192913411 X:75629667-75629689 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1192921311 X:75709753-75709775 AGGTGTTTGCATGGTTTTGAAGG + Intergenic
1192969475 X:76216796-76216818 ATGTATTTGCATGATTTTGAAGG + Intergenic
1192987054 X:76411144-76411166 ATGTATTTGCATGGGTTTGAAGG - Intergenic
1192991645 X:76465165-76465187 ATGTATTTGCAAGATTTTGAGGG + Intergenic
1192993712 X:76489858-76489880 AAGTATTTGCATGGTTTTTAGGG + Intergenic
1193077255 X:77367397-77367419 ATGTATTTGCATGATTTTGGAGG - Intergenic
1193078190 X:77377694-77377716 ATGTATTTTAATGGTCTTGAGGG - Intergenic
1193154909 X:78161731-78161753 ATGTATTTGCATGGCTTTGAGGG - Intergenic
1193157134 X:78186014-78186036 ATGTATTTGCATGGCTTCAAAGG - Intergenic
1193182537 X:78475139-78475161 ATGTAGTTGCATGGTTTTGAAGG + Intergenic
1193185763 X:78510336-78510358 ATGTATTTGCACGTTTTTAAGGG - Intergenic
1193222616 X:78944637-78944659 CTGTATTCACATAGTTTTGAAGG + Intergenic
1193253162 X:79317068-79317090 ATGTATTTGCATGGTTTTGGAGG + Intergenic
1193314836 X:80052661-80052683 ATGTATGTGCATGGTTTTGAGGG + Intergenic
1193347993 X:80426603-80426625 ATGTATATACAGAGTTTTCATGG + Intronic
1193349764 X:80448430-80448452 ATGTATTTAGGTGCTTTTAAAGG - Intergenic
1193366537 X:80640563-80640585 ATGTATTTGAATGGTTTTGAGGG - Intergenic
1193415482 X:81217544-81217566 ATGTATTTGTATAGTTTTGAGGG + Intronic
1193421055 X:81282526-81282548 ATGTATTTCCATGGTTTTGAAGG - Intronic
1193423541 X:81313758-81313780 ATGTATTTTCATGGTTTCGAAGG + Intergenic
1193437885 X:81501083-81501105 ATGTATTTGTATGGTTTTGAAGG + Intergenic
1193446694 X:81614072-81614094 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1193541004 X:82772725-82772747 ATGTATCCACATGGTTTTGAAGG + Intergenic
1193578754 X:83235223-83235245 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1193636039 X:83949638-83949660 AAGTATTTGCATGGTTTTGAAGG - Intergenic
1193723372 X:85013613-85013635 ATGTATTTGTATAGTTTTGAGGG + Intronic
1193771797 X:85596291-85596313 ATCTGTTTATATGGTTTTGAGGG - Intergenic
1193937373 X:87639559-87639581 ATGTACTTGCATGGTTTTGAGGG - Intronic
1193950730 X:87795046-87795068 ATGTATTTGCGTGGTTTTGAAGG + Intergenic
1193966634 X:87995647-87995669 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1193989446 X:88287694-88287716 TTCTATTTACATCTTTTTAAAGG - Intergenic
1193994564 X:88348822-88348844 ATGTATTTATATGGTTTTAAGGG - Intergenic
1194001543 X:88435519-88435541 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194014499 X:88602776-88602798 ATGTATTTGCATAATTTTGAGGG + Intergenic
1194058619 X:89168184-89168206 GTCTATTTGCATGGTTTTGAGGG - Intergenic
1194103401 X:89736131-89736153 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194104343 X:89750456-89750478 ATGTATTTGTATGATTTTGAAGG + Intergenic
1194165561 X:90510511-90510533 ATGTACTTGCATGGTTTTGAAGG - Intergenic
1194237478 X:91401961-91401983 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194381328 X:93194986-93195008 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1194384943 X:93240697-93240719 ATGTATTTTTATAGTTTTGAGGG - Intergenic
1194438862 X:93904268-93904290 ATGTATTTGCATAGTTTTGAGGG + Intergenic
1194466377 X:94239099-94239121 ATGTATTTACATGGTTTTGAAGG - Intergenic
1194504954 X:94723077-94723099 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1194516161 X:94856935-94856957 ATGTATTTGCATGATTTTGAGGG - Intergenic
1194543233 X:95201081-95201103 ATGCATTTGCATGGTTTTGAAGG + Intergenic
1194557137 X:95373776-95373798 ATGTAATTGCATAGTTTTGACGG - Intergenic
1194602426 X:95939017-95939039 ATGTATTTGCATGGTTTCGTGGG + Intergenic
1194630500 X:96276992-96277014 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194684977 X:96902075-96902097 ATGTATTTGCATAGCTTTGAGGG + Intronic
1194780088 X:98013665-98013687 ATGTTTCTACATGGCTTTAATGG - Intergenic
1194807856 X:98351578-98351600 ATGTATTGTTATGGTTTTGATGG - Intergenic
1194816780 X:98451577-98451599 ATGTTGATACCTGGTTTTAATGG + Intergenic
1194882344 X:99269618-99269640 ATGTATTGGCATGGTTTTGAAGG + Intergenic
1194902024 X:99523756-99523778 ATGTATATACATAGTTTTCATGG - Intergenic
1194926437 X:99830703-99830725 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1194934739 X:99935361-99935383 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194955797 X:100178922-100178944 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194967580 X:100306261-100306283 ATGTATTTGCATGGTTTTGAAGG - Intronic
1195015841 X:100779905-100779927 ATGTATGTACATCATTTTGAAGG + Intergenic
1195019273 X:100810307-100810329 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1195110048 X:101639420-101639442 AATTATTAACATGTTTTTAATGG - Intergenic
1195237350 X:102914038-102914060 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1195526474 X:105896227-105896249 ATGTACTGACATGATTTTTATGG - Intronic
1195838513 X:109146499-109146521 ATGTATTTGCATAGTTTTGAGGG - Intergenic
1195984931 X:110619330-110619352 ATGTATTTGCATGTTTTTGAAGG + Intergenic
1196024383 X:111024996-111025018 ATGTATTTGCATGGTTTTGAGGG - Intronic
1196161554 X:112489856-112489878 ATGTATTTCCATGGTTTTGAAGG - Intergenic
1196171130 X:112589913-112589935 ATGTATTTGCATAGTTTTGTAGG - Intergenic
1196219132 X:113090752-113090774 GTGTATTTGCATGGTTTTAAAGG - Intergenic
1196224941 X:113155515-113155537 ATGTATTTGCATGGTTTTGGAGG + Intergenic
1196465081 X:115963478-115963500 ATGTAATTGCATGGCTTTGAAGG - Intergenic
1196477836 X:116109606-116109628 ATGTATTTGTGTGGCTTTAAAGG + Intergenic
1196530919 X:116785407-116785429 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1196621189 X:117826270-117826292 ATGTATTTGTATAGTTTTAAGGG + Intergenic
1196675512 X:118416477-118416499 ATGTATTTGCACGGTTTCGAAGG + Intronic
1196947985 X:120847561-120847583 AAGCATTTGCATGGTTTTGAAGG + Intergenic
1197054142 X:122096980-122097002 ATTTATTTGCATGGTTTTAAGGG + Intergenic
1197055274 X:122111320-122111342 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197065994 X:122234896-122234918 GTGTATTTGTATGGTTTTGAAGG + Intergenic
1197120312 X:122883120-122883142 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1197132689 X:123022841-123022863 ATGTATTTGCATGGTTTTGCAGG - Intergenic
1197184612 X:123572848-123572870 ATGCATTTGCATGGTTTTGAGGG - Intergenic
1197363804 X:125538852-125538874 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1197393077 X:125892898-125892920 ATGTATTTGCGTGGCTTTCAGGG + Intergenic
1197463637 X:126774034-126774056 ATGTAGTTACATAGTTTTGAGGG - Intergenic
1197476081 X:126927258-126927280 ATGTATTTACATGGTTTTGAAGG + Intergenic
1197515313 X:127420653-127420675 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1197519160 X:127475572-127475594 ATGTAGTGGCATGGTTTTGAAGG - Intergenic
1197565085 X:128073751-128073773 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1197571953 X:128160787-128160809 AGGTATTTGCATGGTTTTTAGGG + Intergenic
1197589138 X:128386638-128386660 ATGTATTTGCATAGTTTTGAAGG - Intergenic
1197604109 X:128564375-128564397 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1197664379 X:129208002-129208024 ATGTATTTGCATGGTTTTAAAGG + Intergenic
1197668844 X:129253515-129253537 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197671351 X:129281667-129281689 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197911223 X:131484523-131484545 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1197953932 X:131926269-131926291 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1198559644 X:137835514-137835536 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1198583123 X:138089117-138089139 ATGTTTTTGCATGGTTTTGAAGG - Intergenic
1198614815 X:138445084-138445106 ATGTATGTAAATGTTTGTAACGG - Intergenic
1198695974 X:139338568-139338590 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1198797043 X:140408200-140408222 ATGTATTGGTATGGTTTTGAGGG + Intergenic
1198886041 X:141338699-141338721 ATGTATTTGCATGGATTTGAAGG + Intergenic
1199057605 X:143316663-143316685 ATGTATTTGCATGGTTTGGAAGG + Intergenic
1199103510 X:143835595-143835617 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1199521255 X:148738911-148738933 ATGTATTTGCATGTATTTGAAGG + Intronic
1199564555 X:149200707-149200729 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1199668792 X:150123660-150123682 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1199821471 X:151453217-151453239 ATGTATTTGCATGATTTTGAAGG + Intergenic
1199821589 X:151454622-151454644 ATATATTTCCATGGTTTTGAAGG - Intergenic
1199913894 X:152317666-152317688 ATGTATTAGCATGGTTTTGAAGG - Intronic
1199926565 X:152472708-152472730 ATGTATTTGCATTGTTTTGAGGG - Intergenic
1200131034 X:153846098-153846120 ATGTATGTAGATGTTTTTAATGG - Intergenic
1200375255 X:155773780-155773802 TTGTAGTTACATGGATTTCAGGG - Exonic
1200456303 Y:3398234-3398256 ATGTATTTGCATGATTTTGAAGG + Intergenic
1201316053 Y:12646792-12646814 ATGTATTTGCAAGGTTTTGAAGG - Intergenic
1201391832 Y:13506046-13506068 ATGTATTTCTATAGTTTTGAGGG - Intergenic
1201394966 Y:13538340-13538362 ATGTAATTATATGGTTTTGAAGG - Intergenic
1201408785 Y:13676674-13676696 ATGTATTTGCATGATTTTGAAGG - Intergenic
1201689756 Y:16750333-16750355 ATGTAGTTATCTGGTTTTGAGGG + Intergenic
1201715184 Y:17036777-17036799 ATATATTTACATGTTCTTACAGG + Intergenic
1201730733 Y:17200007-17200029 ATTTACTTACATGAATTTAAGGG + Intergenic
1201934488 Y:19393299-19393321 ATGTATTTACAAGGCTTTGAAGG + Intergenic
1202302701 Y:23434534-23434556 ATTTATTTGCATCGTGTTAAAGG - Intergenic
1202568110 Y:26236060-26236082 ATTTATTTGCATCGTGTTAAAGG + Intergenic