ID: 1044905100

View in Genome Browser
Species Human (GRCh38)
Location 8:96992054-96992076
Sequence TTGCTGCCACACACCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044905100_1044905101 -8 Left 1044905100 8:96992054-96992076 CCTTGATGGGTGTGTGGCAGCAA 0: 1
1: 0
2: 2
3: 13
4: 166
Right 1044905101 8:96992069-96992091 GGCAGCAATCATCAACAGCAAGG No data
1044905100_1044905103 18 Left 1044905100 8:96992054-96992076 CCTTGATGGGTGTGTGGCAGCAA 0: 1
1: 0
2: 2
3: 13
4: 166
Right 1044905103 8:96992095-96992117 CCTTCTCTGCTTATCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044905100 Original CRISPR TTGCTGCCACACACCCATCA AGG (reversed) Intronic
901172475 1:7269776-7269798 TTTCTGCCACCCACTCCTCATGG - Intronic
902732273 1:18377260-18377282 GTGCAGCCACACAACCTTCAGGG - Intronic
903373146 1:22849913-22849935 CAGCTGCCACACACCTTTCAGGG - Intronic
904038897 1:27573087-27573109 TTCCTGAGACACACCCTTCAGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906673937 1:47679659-47679681 TTTCTGCCACACACCTCCCATGG + Intergenic
907586693 1:55624408-55624430 CTCCTGCCACACTCCCATGAGGG - Intergenic
908121318 1:60988731-60988753 TCGCTGCCACACAGCCGCCATGG + Intronic
908610827 1:65858434-65858456 TTGCAGCCAAATAGCCATCACGG - Intronic
909751603 1:79167777-79167799 TTGCTGCCAAATATCCATAATGG - Intergenic
912623890 1:111192193-111192215 CTGCTGCCCCACCCCCTTCATGG - Exonic
915890256 1:159766812-159766834 ATTCTGCCACACATTCATCAAGG + Intergenic
916282506 1:163067783-163067805 TTCCTTCCACACCACCATCAAGG + Intergenic
917472664 1:175338924-175338946 TTGCTGCCACACACCCGTCGAGG + Intronic
917787356 1:178473055-178473077 TTCCTACAACACACCAATCATGG - Exonic
918063783 1:181085721-181085743 ATGCTCCCACTCACCCATCCAGG - Intergenic
918572783 1:186018285-186018307 TTGCTGCCATGCACCGATAAAGG - Exonic
920091298 1:203455146-203455168 TTCCTGCCCCAAACCCACCAAGG + Intergenic
920597195 1:207283933-207283955 TGGTTTCCACACAACCATCAGGG - Intergenic
921915268 1:220601976-220601998 TTACTGCCACAGAACCATGATGG - Intronic
924175898 1:241390874-241390896 TTATTCCCACCCACCCATCATGG + Intergenic
1064032424 10:11891343-11891365 GTGCTGCCACACACCCACCAGGG - Intergenic
1067802441 10:49368350-49368372 GTGCTGCCTCACACTCATCTTGG - Intronic
1069909753 10:71751859-71751881 TTGCTGCCACAGAACCAGAATGG + Exonic
1070416057 10:76190575-76190597 CTGCTACCACACACCCATCTGGG - Intronic
1070918610 10:80170392-80170414 TACCTGCCACACACCCACCAAGG + Intronic
1073510190 10:104037986-104038008 TTGCTGGCCCACAGCCCTCATGG - Intronic
1076251380 10:128986456-128986478 TAGCTGCCACACACCCAGGCTGG - Intergenic
1076853942 10:133106149-133106171 TCCAGGCCACACACCCATCAGGG - Intronic
1076885318 10:133259462-133259484 TTGCTGCCACACGTGGATCATGG - Intergenic
1077921048 11:6641845-6641867 GTGCTGCCTCACACTCATCTTGG + Intronic
1079109354 11:17595746-17595768 TTGCTTCCTCACAGCCAGCAAGG + Intronic
1083109231 11:60388608-60388630 TCCCTGCCACACACCCATAGAGG - Intronic
1084169408 11:67393413-67393435 ATGCAGGCCCACACCCATCATGG - Intronic
1085783124 11:79427193-79427215 ATGCTTCCACAGGCCCATCACGG + Intronic
1086447759 11:86886298-86886320 TTGAGGCCACACTCCCTTCAGGG + Intronic
1087727699 11:101741250-101741272 TGGCTGCCAAACACCCATTCTGG + Intronic
1089940292 11:122409531-122409553 TTTCACCCACACCCCCATCAAGG - Intergenic
1090324027 11:125869592-125869614 TTGCTCCCCCACACCCTTTAGGG + Intergenic
1090873241 11:130766488-130766510 TTAGAGCCACACATCCATCATGG - Intergenic
1090953752 11:131496733-131496755 TGGCAGCCACACACCCATTTGGG - Intronic
1091048172 11:132344005-132344027 TTTCTGGCACATACCCAACACGG + Intergenic
1092788935 12:12055117-12055139 TTGCTCCCACTCACACATCTAGG + Intronic
1095231009 12:39740020-39740042 TAGCTGCCACACAGCCAACATGG + Intronic
1101724642 12:107378802-107378824 ATGCAGCCAAAGACCCATCAGGG - Intronic
1101989462 12:109473090-109473112 TGGATGCCACAGCCCCATCAGGG + Intronic
1103202619 12:119100713-119100735 TTTCTGCCTAACACCCAGCAAGG - Intronic
1105418302 13:20231999-20232021 GTGCGGCCAGACACCCATCCCGG + Intronic
1106801008 13:33255725-33255747 TTTCTGCCACACTCCCTCCAGGG + Intronic
1114953735 14:27791474-27791496 ATGCTGACACACACACATCTAGG + Intergenic
1115950022 14:38710471-38710493 TTTCTTCCACACATCCCTCATGG + Intergenic
1117354021 14:54906248-54906270 TTTCTCCCACACACCAAGCAGGG - Intergenic
1118841659 14:69517846-69517868 TACCTGCCTCACTCCCATCAGGG + Intronic
1119336335 14:73836668-73836690 TTGCTGCCCCACACCAACAAAGG + Intergenic
1119479726 14:74951852-74951874 TTTCTCCCACACACCCATAGCGG - Intronic
1120888935 14:89474428-89474450 GTTCTGCCACACATACATCAAGG - Intronic
1121851577 14:97226066-97226088 ATGCTTCCCCACCCCCATCATGG - Intergenic
1122292388 14:100686812-100686834 CTGCTGCCACAGTCCCTTCAGGG + Intergenic
1122531670 14:102432139-102432161 TAGCTGGCACACACCCATCTGGG + Intronic
1122905125 14:104798064-104798086 CTCCTGCCCCACACCGATCAGGG - Intergenic
1123505720 15:20940544-20940566 TTGCCACCACACACCATTCAAGG - Intergenic
1123562954 15:21514250-21514272 TTGCCACCACACACCATTCAAGG - Intergenic
1123599201 15:21951533-21951555 TTGCCACCACACACCATTCAAGG - Intergenic
1124351302 15:28957589-28957611 CTGCTACCCCACTCCCATCAGGG - Intronic
1129064363 15:72888854-72888876 TTGCAGACCCAGACCCATCACGG - Intergenic
1129176246 15:73841640-73841662 TTGCTCCCCTACAGCCATCACGG - Intergenic
1129380014 15:75158783-75158805 TTGCTGCCCCACACCCAGAGTGG - Intergenic
1129457590 15:75683914-75683936 GTGCTGCCACACAGCCGTCCTGG + Intronic
1129726198 15:77903031-77903053 ATGCTGCCACACAGCCGTCCTGG - Intergenic
1202971306 15_KI270727v1_random:241385-241407 TTGCCACCACACACCATTCAAGG - Intergenic
1132646922 16:1003431-1003453 CTGCTGCCACAGCCCCCTCATGG + Intergenic
1133337320 16:5014638-5014660 AGCCTGCCACAGACCCATCAGGG - Intronic
1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG + Intronic
1134230592 16:12426225-12426247 CTCATGCCACACATCCATCATGG + Intronic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1138370547 16:56523303-56523325 TCCCTGCCAAGCACCCATCAGGG + Intergenic
1138492540 16:57384681-57384703 ATGCTGCGCCACACCCAGCAGGG - Exonic
1138582856 16:57952937-57952959 ATGCTGCCACACAGCCCCCAGGG + Intronic
1140037103 16:71379746-71379768 TTGCTGCCACACAGGCTTCTGGG - Intronic
1142150330 16:88509862-88509884 TTGCTGCCACACGCGCGTCACGG + Intronic
1144864347 17:18325328-18325350 TTGCTGGCACACACCCTCAAGGG + Intergenic
1149851140 17:60035261-60035283 TTGTTGCCCCACCCCAATCAAGG + Intergenic
1149859024 17:60111246-60111268 TTGTTGCCCCACCCCAATCAAGG - Intergenic
1150299883 17:64038955-64038977 TTTCTGACACACAGCCACCATGG + Intergenic
1152334098 17:79690545-79690567 AGGCTGCCTCACACACATCATGG + Intergenic
1152896396 17:82913831-82913853 TTGCTGCCACCTACCCATGATGG + Intronic
1160766547 19:811177-811199 CTGCAGCCACACACCCACCCGGG + Exonic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164523161 19:28994353-28994375 TAGGTGCCACACACCCCACAGGG + Intergenic
1164841746 19:31398001-31398023 TGGCACCCAGACACCCATCAGGG - Intergenic
926245924 2:11122420-11122442 TCGCTGCTACACTCCCACCAGGG - Intergenic
926873182 2:17445936-17445958 TTGCTGCCACCCCTCCACCAAGG - Intergenic
927657044 2:24957875-24957897 TTTCTGCCAGCCACGCATCAAGG + Exonic
934111444 2:88747259-88747281 CAGCTGCCACACAGCCAGCAAGG + Intronic
934483535 2:94677498-94677520 ATGCTGACACACACACATCTAGG - Intergenic
934921909 2:98350956-98350978 TGGCTGTCCCAAACCCATCAAGG - Intronic
935226869 2:101060355-101060377 TTGCTGCAACACAACAAGCAAGG + Intronic
935435523 2:103027848-103027870 TAGCTGCCCCACAACCATGAGGG + Intergenic
935684366 2:105670507-105670529 CTGCTGCCACACACCTTCCATGG - Intergenic
939330953 2:140760583-140760605 TTGCTGTGAAACACCCATCCTGG + Intronic
943761442 2:191613818-191613840 GTGCTGCCCCACACCCCACAGGG - Intergenic
944821803 2:203440045-203440067 TTGCTGACACACACCCTTGTTGG + Exonic
948106662 2:235419978-235420000 TTGCTTCCACACAGCCAGCTCGG + Intergenic
948996787 2:241584798-241584820 TGCATGCCACACACTCATCACGG + Intronic
949011109 2:241679060-241679082 TTTCTGCCACACACACGCCAGGG + Intronic
1173563132 20:44020545-44020567 TGGCAGCCACACTCCCAGCAGGG + Intronic
1175841897 20:62033255-62033277 TTCCTGCCACACACGCATCTTGG - Intronic
1176230619 20:64030932-64030954 TTGCTGCCACCCTCTCCTCAGGG - Intronic
1177471645 21:21567333-21567355 TTGCTGTCACACAGCCATAGTGG - Intergenic
1178183862 21:30196778-30196800 TTGCTGGCAAATACCCATCTTGG + Intergenic
1178856021 21:36251003-36251025 TTGCTGGGATCCACCCATCAGGG + Intronic
1179104137 21:38383484-38383506 TTGCTGCCCCAAACCCATACTGG - Exonic
1183663360 22:39234107-39234129 TCCCTGCCACACACCCTTCTAGG + Intronic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
1184767230 22:46578022-46578044 CTTCTGCCACACAGCCAACAGGG - Intronic
1184925062 22:47630885-47630907 TTGCTGTCACCCACCCTCCAGGG - Intergenic
950777916 3:15366188-15366210 TCGCTTCCACACCCCAATCAAGG - Intergenic
951425555 3:22540556-22540578 CTGCTCCAACCCACCCATCAGGG - Intergenic
952085001 3:29809902-29809924 TTGCTACCACCCCACCATCATGG + Intronic
952183258 3:30941743-30941765 CAGCTGCCACACAGCCAGCAAGG + Intergenic
952903922 3:38127424-38127446 ATGCTGCCACAGACCCAGCATGG + Intronic
952956956 3:38563445-38563467 TTGCCCCCACTCACCCCTCAAGG + Intronic
953070510 3:39515142-39515164 ATGCTGACACACCCCCTTCAGGG + Exonic
953413723 3:42703764-42703786 GTGCTGCTCCCCACCCATCAGGG + Intronic
958424911 3:93968796-93968818 TTGTTGCCACATACTAATCAGGG + Intronic
960534683 3:118802946-118802968 TTGCAGCCACACAGCCAACCTGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962284132 3:134072731-134072753 TTGCTGCTACACATCCTTCAGGG + Intronic
965951692 3:174316570-174316592 TTACTGCCCCAGTCCCATCAAGG + Intergenic
968438724 4:610562-610584 TGGCTGCCTCACAGCCTTCAGGG - Intergenic
968729674 4:2263731-2263753 GTGCTGCCACACACGGCTCAGGG + Intergenic
969328949 4:6461873-6461895 TTCCTGCCACATCCCCATCATGG + Intronic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
971823662 4:31592836-31592858 CTGCTGCCACTTACCCACCAGGG + Intergenic
976914847 4:90359959-90359981 TTGCTCCCACACACCAGCCAGGG - Intronic
978414023 4:108456861-108456883 TTGCTGCCACACTGCCCTCATGG + Intergenic
982258973 4:153476987-153477009 TTGCTCCCACACACCCAAAAAGG - Intronic
982821860 4:159950873-159950895 CTGCTGCCAAAAACCCAGCATGG + Intergenic
985329351 4:188811905-188811927 TTCATGTCACAAACCCATCAGGG + Intergenic
990016038 5:51063790-51063812 TGGCTGCCACACCTCCCTCAAGG - Intergenic
995452876 5:112321848-112321870 TTTCTGCCACAGCCACATCATGG - Intronic
995470112 5:112492445-112492467 TTGCTGCCAAACTCTCAGCAAGG - Intergenic
996609037 5:125357766-125357788 CTGCTCCCACACAGCCAGCAAGG + Intergenic
996766936 5:127044002-127044024 ATGCTGCAACAAAGCCATCAGGG + Exonic
1004244630 6:13961830-13961852 ATGCTGCCAAACAACCATTAGGG + Intronic
1006582031 6:35082822-35082844 TTGCTCCCACCCTCCCAGCAGGG + Intronic
1007383989 6:41508341-41508363 TTGCTGACACCTTCCCATCACGG - Intergenic
1009859337 6:69306118-69306140 TTGCTTCCCCCCACCCATGAAGG - Intronic
1010975888 6:82313193-82313215 CAGCTCCCACACAGCCATCAAGG - Intergenic
1012515735 6:100057089-100057111 TTGCAGCCACACAGTCCTCATGG - Intergenic
1013495545 6:110693585-110693607 TAGCTCCCACACAGCCAGCAAGG - Intronic
1023381659 7:39614242-39614264 TGCCTGCCACCCACCCCTCAAGG - Intergenic
1023531300 7:41157907-41157929 TTCCTCTCACACACACATCATGG + Intergenic
1026843960 7:73686935-73686957 TGGCTTCTCCACACCCATCAGGG - Intronic
1027477115 7:78646987-78647009 TTACTGTCACCCACCCACCAAGG - Intronic
1031750422 7:125564299-125564321 CCGCTGTCACACACCCAGCAAGG + Intergenic
1032425609 7:131820060-131820082 TGGCAGCCAAGCACCCATCAGGG - Intergenic
1035001546 7:155616405-155616427 ATACCGCCTCACACCCATCAGGG - Intronic
1037762914 8:21753905-21753927 TTCCTGGAACACGCCCATCACGG + Intronic
1038157815 8:25007452-25007474 CTTCTACCACACACGCATCAGGG - Intergenic
1038398619 8:27266214-27266236 TGGCTGCCTCACAGCCATGAAGG + Intergenic
1040463548 8:47673242-47673264 TTGCAGCAACACAGCCATGATGG - Intronic
1042588516 8:70370438-70370460 TAGCTGCCACAAACCCATGATGG - Intronic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1046621129 8:116530864-116530886 TTTCAGCCACACAGCCATCTCGG + Intergenic
1046870206 8:119197367-119197389 TTCCTGCCACACCCCAATCCTGG - Intronic
1049013468 8:139903651-139903673 TTCCTTTCACACACTCATCACGG + Intronic
1053674248 9:40406884-40406906 ATGCTGACACACACACATCCAGG + Intergenic
1053924051 9:43033252-43033274 ATGCTGACACACACACATCCAGG + Intergenic
1054385355 9:64546951-64546973 ATGCTGACACACACACATCCAGG + Intergenic
1054510373 9:65969406-65969428 ATGCTGACACACACACATCCAGG - Intergenic
1055337874 9:75251465-75251487 TTGCTGCCACTACCCCACCATGG - Intergenic
1056166066 9:83941965-83941987 TAGCTGCATCACACCAATCATGG - Intronic
1056539257 9:87557212-87557234 TGGCAGCCACACATCCATCCAGG + Intronic
1056684805 9:88750805-88750827 TTGCTGCCACATTTCCATCCTGG - Intergenic
1061789638 9:133052283-133052305 TTCCTGCCCCACCCCCATCCTGG + Intronic
1187192240 X:17046070-17046092 TTGCTGCTAAAGAGCCATCAAGG - Intronic
1192210648 X:69125713-69125735 TCACTGCCACACAGCCCTCATGG + Intergenic
1195154946 X:102113594-102113616 TGGCTGCCACACACCCTGCCAGG + Intergenic
1197653862 X:129094692-129094714 GTGCTGCCCCTCACACATCAAGG - Intergenic
1198761410 X:140036613-140036635 TCACTGCTACACTCCCATCAGGG - Intergenic
1201587601 Y:15578045-15578067 TTCCTTCCACGCAGCCATCAGGG - Intergenic