ID: 1044905313

View in Genome Browser
Species Human (GRCh38)
Location 8:96994725-96994747
Sequence CTAGGTCAACAGGAATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044905313_1044905319 27 Left 1044905313 8:96994725-96994747 CCAATTTATTCCTGTTGACCTAG 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1044905319 8:96994775-96994797 ATCTCAACATGTTCCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044905313 Original CRISPR CTAGGTCAACAGGAATAAAT TGG (reversed) Intronic
901603278 1:10439263-10439285 CTTTGTAAGCAGGAATAAATAGG - Intronic
902891761 1:19449223-19449245 CCAGGACAACAGGAACAAAGTGG + Intronic
910663606 1:89700639-89700661 TTAGGTCAACAGGGAAAACTTGG + Intronic
911791556 1:102022302-102022324 GTAGGTCAAAAGGAACAAAACGG - Intergenic
912220657 1:107670848-107670870 CTAGCAAAACAGGAAGAAATTGG - Intronic
915541650 1:156570927-156570949 CTAGATCTTAAGGAATAAATAGG + Intronic
917643862 1:177010192-177010214 CTAGGACAACAAGGACAAATTGG - Intronic
918239563 1:182609687-182609709 GTAAGTCATCAGTAATAAATGGG + Intergenic
918669929 1:187202388-187202410 CTAGCACCACAGAAATAAATAGG + Intergenic
919482802 1:198110023-198110045 GAAGGTCAAAAGTAATAAATGGG - Intergenic
922635343 1:227164110-227164132 CCAGGATAACAGGCATAAATTGG + Intronic
1066028420 10:31390376-31390398 CTAGGTCATTAGGAAGAAATGGG - Intronic
1066029140 10:31399619-31399641 TTAAGTCAACAGGAAAAAACAGG - Intronic
1066585229 10:36926228-36926250 CTAGTTTGACAGGAATAAGTTGG - Intergenic
1067668423 10:48298714-48298736 CTGGGGCAACAGGTATAAACTGG + Intergenic
1069678442 10:70266392-70266414 CTAGGACCAAAGGAATATATTGG + Intronic
1069760221 10:70805329-70805351 CTGGGACAACAAGCATAAATTGG - Intergenic
1069786599 10:70992351-70992373 CTAGGGCAACAGGAGTAAGCAGG + Intergenic
1070964298 10:80520219-80520241 CCAGGTCTACAGGAATAGATGGG - Exonic
1071369670 10:84938542-84938564 CCAGGTGAACAGGAAAAAATGGG + Intergenic
1077745949 11:4905766-4905788 CAAGGTAAACAGGTAAAAATTGG - Intronic
1078965325 11:16333226-16333248 CTAGATCAGCAGGAATAAGATGG - Intronic
1079013428 11:16848260-16848282 CTAGGGAAACAGCAATGAATAGG - Intronic
1080812254 11:35716377-35716399 CTAGGTTAAAAGGTCTAAATGGG + Intronic
1080983817 11:37437738-37437760 TTAGGTCAATAGTAACAAATGGG - Intergenic
1083799482 11:65038271-65038293 CTAGGTCAACTGGAGTCAAGAGG + Intronic
1085471851 11:76763538-76763560 CCAGGTCCACAGGAATACTTTGG + Intergenic
1085876132 11:80407728-80407750 ATAGGTCAACATGAAGAGATAGG + Intergenic
1086753707 11:90531871-90531893 CTAGGACAACAGGATTATCTGGG + Intergenic
1087185500 11:95188652-95188674 CTAGGTCTTGAAGAATAAATGGG - Intronic
1090105478 11:123850628-123850650 CTAGTTCTCCAGCAATAAATTGG - Intergenic
1092310078 12:7342955-7342977 GCAGGTAAACAGGTATAAATTGG - Intergenic
1092946842 12:13464260-13464282 CTAGGTGGACTGGAATAAAGTGG + Intergenic
1097505873 12:60469140-60469162 ATAGGTAAACAGGAGTTAATAGG + Intergenic
1099565952 12:84246556-84246578 CTATTTCAAATGGAATAAATTGG - Intergenic
1099568556 12:84283900-84283922 TGAGCTCAACAGAAATAAATTGG + Intergenic
1099906722 12:88779910-88779932 CTGGGACAACAGATATAAATTGG - Intergenic
1101383147 12:104231857-104231879 CTTGGTCCACAGGAATAAGCAGG + Intronic
1102712101 12:114937307-114937329 CTAAGGCCACAGCAATAAATAGG - Intergenic
1102897890 12:116613114-116613136 CTAGGACTACAGGCATACATAGG + Intergenic
1105518552 13:21111770-21111792 CCAGGACAACAGGTGTAAATGGG - Intergenic
1106355688 13:28980923-28980945 CTAGGGCAACAGGCATAAGCCGG + Intronic
1108131984 13:47311102-47311124 CTATGTCACCAGGAATATCTGGG - Intergenic
1112566279 13:100553439-100553461 CTATGGCAACAAGAATGAATAGG + Intronic
1112642347 13:101290109-101290131 CTTAATCAAGAGGAATAAATTGG - Intronic
1112677764 13:101723213-101723235 CTAGGACAGCAGGTTTAAATGGG + Intronic
1113439511 13:110316744-110316766 GTAGGTCAATAGGAACAAAGTGG + Intronic
1114755578 14:25255926-25255948 CTGGGTCAGCAGGATTAAAGAGG - Intergenic
1115348622 14:32369053-32369075 CTGGGACAACAGGCATAAACTGG + Intronic
1115811082 14:37107918-37107940 CTGGGCCAACAGGCATAAACTGG - Intronic
1116797482 14:49407451-49407473 CTCTGTAAACAGGAATAAAAGGG + Intergenic
1119167520 14:72507494-72507516 ATAGTTCAGCAGAAATAAATGGG - Intronic
1123974359 15:25538881-25538903 ATAGGACAACAGGCATAAATTGG - Intergenic
1125643378 15:41250140-41250162 CTTGGTCAACAAGGTTAAATAGG + Intronic
1126686977 15:51256961-51256983 CCAGGACAACAGGCATAAATTGG - Intronic
1134562961 16:15226659-15226681 TTAAGACAACAGGTATAAATTGG - Intergenic
1134923498 16:18138292-18138314 TTAAGACAACAGGTATAAATTGG - Intergenic
1135492325 16:22920279-22920301 CCAGGACAACAGGTATAAACTGG - Intergenic
1137663588 16:50233002-50233024 CTAGGAGAACAAGAATAGATGGG - Intronic
1137793336 16:51193895-51193917 ATAGGTAAAAAGGAAGAAATTGG - Intergenic
1140141445 16:72261886-72261908 CTGGGACAACAGGCATAAACTGG - Intergenic
1147185407 17:38710743-38710765 CCAGGGCAACAGGTATAAACTGG - Intronic
1149025168 17:52018532-52018554 CTATTTCAAAAGGGATAAATTGG - Intronic
1149080811 17:52654895-52654917 TTAAATCAACAAGAATAAATTGG - Intergenic
1149374322 17:56029036-56029058 CTAGGTCACCAGGTAGCAATTGG + Intergenic
1150998332 17:70345101-70345123 CTGCTTAAACAGGAATAAATTGG - Intergenic
1154311019 18:13266220-13266242 CTGGGTCCACAGGAAGAAGTCGG - Intronic
1156278652 18:35610480-35610502 CTAGATCTACAGCAATAAACAGG - Intronic
1156486096 18:37466653-37466675 CTGGGTCCACATGAATAAGTAGG + Intronic
1157728972 18:49987543-49987565 CTAGTTCAACAGGCAGAGATTGG + Intronic
1157821994 18:50778904-50778926 GTAGGTTCACAGGAATAAGTGGG - Intergenic
1158491701 18:57916190-57916212 CTAGGACAAAGGGACTAAATGGG - Intergenic
1158740748 18:60139506-60139528 TTAGCTCAAGAGAAATAAATGGG - Intergenic
1159029901 18:63220299-63220321 CAGGGACAACAGGTATAAATTGG - Intronic
1163997923 19:21069469-21069491 CAAAGTCAACAGAAATAAAGGGG + Intergenic
1164142180 19:22481531-22481553 CAAAGTCAACAGAAATAAAAAGG + Intronic
926991010 2:18680200-18680222 CTAGGAAAACAGGAACAAATTGG - Intergenic
928333625 2:30377112-30377134 CTGGGACAACAGGTATGAATGGG - Intergenic
929087613 2:38183800-38183822 CTAGGAAAACAGGAATTCATCGG + Intergenic
929240521 2:39648752-39648774 CTATGTCTAAAGGATTAAATTGG - Intergenic
935352662 2:102167119-102167141 CTGGGACAACAGGTATAAATTGG + Intronic
935823767 2:106920900-106920922 GAAGGTGAAGAGGAATAAATGGG - Intergenic
937170605 2:119862903-119862925 TTCAGTCAACAGGCATAAATTGG - Intronic
937600120 2:123721494-123721516 CTTGGTCAACAGGAAAAAATTGG - Intergenic
937759494 2:125583656-125583678 CAAGGTCCACAGGAATATTTGGG - Intergenic
939110275 2:137998417-137998439 CTAAGTCAACAGGTATAAAATGG + Intronic
939653881 2:144798462-144798484 CTAAGTCAAGGGAAATAAATGGG - Intergenic
940748011 2:157592526-157592548 CCAGTTGAACTGGAATAAATGGG - Intronic
942423437 2:175833419-175833441 CTATTTCAACAAGAATATATAGG + Intergenic
943057814 2:183005265-183005287 CTAGGGCAACTAAAATAAATTGG - Intronic
944059421 2:195556759-195556781 TTAGGTCAACAGGTATAAATTGG - Intergenic
1169797307 20:9477331-9477353 CTAGGACTACAGGCATAAACTGG + Intronic
1173271159 20:41536268-41536290 CTAGGAAAACAGGAATGAAATGG + Intronic
1177260279 21:18720883-18720905 CTAGATAGACAGGAAAAAATAGG + Intergenic
950695848 3:14700758-14700780 ATAGGACAACAGGCATAAACTGG - Intronic
951431440 3:22612132-22612154 CTAGGTTAAAAGCACTAAATAGG - Intergenic
951783914 3:26397004-26397026 CAAGGTCAACAGCCATCAATAGG - Intergenic
952075615 3:29693479-29693501 TTAGCTCAATAGAAATAAATTGG - Intronic
952564502 3:34638809-34638831 GTAATTCAACAGGAATAAAGTGG + Intergenic
952579434 3:34814674-34814696 TGGGGTCAACAGGAATGAATAGG + Intergenic
952848724 3:37710690-37710712 CTAGGACAACAGGCAGAAACCGG + Intronic
955536434 3:59928685-59928707 CTAGGGCAACTGTAATAAAAAGG + Intronic
956494318 3:69808334-69808356 CTAGGGCAGCAGGTATAAACTGG + Intronic
958889984 3:99772584-99772606 TTAGGTTTACAGGAATATATGGG - Intronic
959283112 3:104372470-104372492 ATAGGAAAACAGGAAAAAATGGG - Intergenic
959605215 3:108234957-108234979 CAAGGCCATCAGGAATATATTGG - Intergenic
962430230 3:135312260-135312282 CTAGCTGAAGAGGAAGAAATGGG + Intergenic
964514050 3:157487857-157487879 TTAGAAAAACAGGAATAAATGGG + Intronic
965007906 3:163049551-163049573 GTATGACAACAGGAATTAATGGG + Intergenic
967128060 3:186443934-186443956 ATTGGTCAACAGGAAAATATTGG - Intergenic
970640915 4:18065019-18065041 CTAGATTCACAGGAATATATTGG + Intergenic
971115074 4:23636342-23636364 TTAGGTCAATAGTAATATATTGG + Intergenic
971615504 4:28785751-28785773 CAAGGAGAACATGAATAAATTGG + Intergenic
973557472 4:52099296-52099318 CTAAGAAAACAGAAATAAATAGG - Intergenic
974238670 4:59214200-59214222 ATGGAGCAACAGGAATAAATGGG + Intergenic
976306678 4:83566573-83566595 ATAAGTAAACAAGAATAAATAGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977452780 4:97220097-97220119 CTTGGTCAACAGGAAACAAGTGG + Intronic
978395387 4:108273746-108273768 CTTGAACAACAGGAAGAAATTGG - Intergenic
978498668 4:109385880-109385902 CTAGGTCAGCAGGAGTCTATGGG + Intergenic
980078140 4:128315676-128315698 CTAGGTAAACAGGAAAACCTGGG + Intergenic
980897312 4:138872277-138872299 ATAGGGCAATAAGAATAAATAGG - Intergenic
981307924 4:143266453-143266475 CCAGCAGAACAGGAATAAATAGG + Intergenic
981973888 4:150699659-150699681 CTATGTTGTCAGGAATAAATGGG - Intronic
981983056 4:150819719-150819741 CTATGTCATCTTGAATAAATAGG - Intronic
989600891 5:43199850-43199872 CTAGGACAACAGGTGTAAACCGG - Intronic
990357999 5:54989363-54989385 CAAGGTCAACAGGACAAATTTGG - Intronic
990384039 5:55242116-55242138 CTAGAGCAACAGAAATAAAAAGG - Intergenic
996487852 5:124057744-124057766 CCAGGACAACAGGCATAAATTGG + Intergenic
996558488 5:124803110-124803132 GAAGGTCAAAAGGAAAAAATGGG - Intergenic
997264573 5:132487588-132487610 CTTGGTCAACACGAAGAAAAAGG + Intronic
998559022 5:143153806-143153828 TTAGGTCACCAGAAATAACTTGG - Intronic
1000172342 5:158714334-158714356 GTATGTGAACAGGGATAAATTGG - Intronic
1003746227 6:9005521-9005543 CTGGGACAACAGGTATAAATGGG - Intergenic
1005125350 6:22440870-22440892 CTAGATAAAAAGCAATAAATGGG - Intergenic
1007500120 6:42290380-42290402 CTAGGGCAAGAGGAAGAAATCGG - Intronic
1008343670 6:50398986-50399008 CTAGCCCAACAGGAAGAACTAGG + Intergenic
1008803813 6:55403658-55403680 TTAGGACAGCAGGAATAAGTAGG + Intergenic
1011766023 6:90621104-90621126 CCAGGACAACAGGTATAAATTGG + Intergenic
1014535439 6:122608230-122608252 TAAGGTTAACAAGAATAAATAGG - Intronic
1016050696 6:139527087-139527109 CTAGGTCACCAGCAAGAAATTGG - Intergenic
1016846342 6:148571781-148571803 CAAGGCCAACAGGAAGAAAGGGG + Intergenic
1018847641 6:167566523-167566545 CTAGTTTAAGAGGAATAAAGAGG - Intergenic
1021492836 7:21238437-21238459 CTTCTTCAACAGGGATAAATTGG - Intergenic
1022191239 7:28018500-28018522 CTAGGACAACGGGTATAAAGTGG - Intronic
1023070769 7:36430713-36430735 CAAGGCCAACAGGTATAAACTGG - Intronic
1024337269 7:48222210-48222232 CCAGGTCAAAAGGAAAATATGGG + Intronic
1024837524 7:53540152-53540174 CTAGTTCAACACGAAAACATTGG - Intergenic
1025821179 7:64966509-64966531 CAAAGTCAACAGAAATAAAGGGG - Intergenic
1028234933 7:88349012-88349034 ATAGGTATACATGAATAAATGGG + Intergenic
1028989846 7:97037031-97037053 CTGGGACAATAGGAGTAAATTGG + Intergenic
1030663844 7:112252062-112252084 TTAGGCCAAAAGGCATAAATGGG - Intronic
1030727851 7:112947088-112947110 CTAAGACAACAGGCATACATTGG + Intergenic
1032276459 7:130460585-130460607 CTGTGACAACAGGTATAAATTGG - Intergenic
1033832247 7:145268769-145268791 CTAAGTCAACAGCAATATATGGG - Intergenic
1035991852 8:4500087-4500109 CTAGGTGAAAAGGTATAAAGAGG + Intronic
1036966960 8:13309867-13309889 CTAAGTCATCAGGAAGAAATTGG - Intronic
1037166393 8:15834528-15834550 CTTGTTAAAAAGGAATAAATAGG - Intergenic
1037687002 8:21149311-21149333 CTTTGTCAACAGCCATAAATAGG - Intergenic
1042098203 8:65242645-65242667 CCAGGTCATTAAGAATAAATTGG + Intergenic
1043325092 8:79040310-79040332 CAAGTACAACTGGAATAAATGGG - Intergenic
1044057644 8:87591437-87591459 CTGGGACAACAGGCATAAAATGG + Intronic
1044277821 8:90322746-90322768 CTAGGGCTGTAGGAATAAATTGG - Intergenic
1044905313 8:96994725-96994747 CTAGGTCAACAGGAATAAATTGG - Intronic
1045099976 8:98834387-98834409 TTAGGTCAACAGAACAAAATTGG + Intronic
1045383955 8:101653433-101653455 CTAGGTCCACAGTAATGAGTAGG - Intronic
1047199427 8:122752409-122752431 CTAGGACAACAGGTGTAAACTGG - Intergenic
1048814711 8:138321607-138321629 CAAGGTCCTCAGGTATAAATGGG + Intronic
1051139602 9:13964219-13964241 CCAGGACAACAGGCATAAACTGG + Intergenic
1055760400 9:79600865-79600887 CTAGGTCCACAGGAAGTAAAAGG - Intronic
1058607846 9:106742703-106742725 CTAGATGAATAGGATTAAATGGG + Intergenic
1058865087 9:109154583-109154605 CTAGGTACACAGAATTAAATTGG + Intronic
1060318877 9:122536826-122536848 CAAAGTCAACAAAAATAAATGGG - Intergenic
1061094743 9:128449458-128449480 AAAGGTCAACAGCAGTAAATAGG + Intergenic
1188601178 X:31966569-31966591 GTAGGTCAACATGTTTAAATGGG + Intronic
1188975179 X:36664478-36664500 GTAGGTCAACAGAAAGAAAATGG + Intergenic
1189100899 X:38188576-38188598 CTGGGACAACAGGCATAAAATGG - Intronic
1189447248 X:41092261-41092283 CAAAGTCAGCAGGAATAAAATGG - Intronic
1190136203 X:47800972-47800994 CTAGGTCACCATTAATAAAAGGG + Intergenic
1191700353 X:64035187-64035209 CTAGGTCAAGAAGAAAGAATCGG + Intergenic
1191793327 X:64994540-64994562 TAAAGTCAACAGGAACAAATTGG - Intronic
1192272078 X:69590518-69590540 ATAGGTGAAAAGGAAAAAATGGG + Intergenic
1193212450 X:78823137-78823159 CTCAGACAACAGGAAGAAATAGG - Intergenic
1193734852 X:85145194-85145216 CTGGGACAACAGGCATAAACTGG + Intergenic
1195085569 X:101410599-101410621 CTAAGGCAACAGGAGTAAAATGG - Intronic
1195765375 X:108290972-108290994 CTAGGCAAACTGGAATGAATTGG - Intronic
1196317791 X:114249580-114249602 CTAGATCAAAAGGCATATATAGG - Intergenic
1196784262 X:119408317-119408339 CTGGGTCTTGAGGAATAAATAGG - Intronic
1196852240 X:119948414-119948436 CTACTTCTACAGGAAGAAATTGG + Intergenic
1198200238 X:134409013-134409035 CTAAGTTAAAAGAAATAAATTGG - Intronic
1198864109 X:141103052-141103074 CTATGTCTACAAGAATGAATGGG + Intergenic
1198898580 X:141484364-141484386 CTATGTCTACAAGAATGAATGGG - Intergenic
1198971896 X:142291333-142291355 ATAGCTCAAGAGGAATAAAGAGG - Intergenic
1199661788 X:150058194-150058216 CCAGTTCAAGAAGAATAAATTGG + Intergenic
1202063585 Y:20913901-20913923 ATTGGTTCACAGGAATAAATGGG - Intergenic