ID: 1044911628

View in Genome Browser
Species Human (GRCh38)
Location 8:97065950-97065972
Sequence TGCTTCAGTGCTTTCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044911628_1044911631 14 Left 1044911628 8:97065950-97065972 CCCAAGGAGAAAGCACTGAAGCA 0: 1
1: 0
2: 5
3: 49
4: 360
Right 1044911631 8:97065987-97066009 AACAATTTTCTCTTGTGTTTAGG 0: 1
1: 0
2: 1
3: 50
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044911628 Original CRISPR TGCTTCAGTGCTTTCTCCTT GGG (reversed) Intronic
900803422 1:4751763-4751785 AGCGTGAGTGCTTTCTCCCTTGG - Intronic
901099334 1:6707255-6707277 TGATACAGTCCTTTGTCCTTTGG + Intergenic
906515709 1:46437701-46437723 AGCTTTTGTGCTTCCTCCTTCGG + Intergenic
907106011 1:51883446-51883468 TTCCTCAAAGCTTTCTCCTTGGG - Intergenic
907963794 1:59309651-59309673 TTCTTTAGTCCTTTCACCTTCGG + Intronic
908154889 1:61342512-61342534 TGCATTAGTGCCTTCTGCTTTGG - Intronic
909061845 1:70887969-70887991 TGCTTCATTGCTTTCTGGTCAGG - Intronic
909353884 1:74684990-74685012 TATTTCAATGCTTTCTCCTATGG - Intergenic
909393320 1:75139188-75139210 AACTTCAGTGCTCTGTCCTTCGG + Intronic
910130533 1:83899719-83899741 TGCTTCGCTGCTTCTTCCTTTGG - Intronic
913975530 1:143451673-143451695 TCCTTCAGTGATTTTTCCTTTGG + Intergenic
914069923 1:144277289-144277311 TCCTTCAGTGATTTTTCCTTTGG + Intergenic
914109232 1:144689065-144689087 TCCTTCAGTGATTTTTCCTTTGG - Intergenic
914735735 1:150414603-150414625 TGTCACAGTACTTTCTCCTTTGG - Intronic
914783572 1:150807926-150807948 TTCTGCAGTGTTTTCTACTTTGG - Intronic
916484877 1:165249789-165249811 TGCTTCAATTCAATCTCCTTAGG - Intronic
917080272 1:171251141-171251163 TGCTTAAGTGCTTTTTACTTGGG + Intronic
917106705 1:171499469-171499491 TTAATAAGTGCTTTCTCCTTTGG - Intronic
917140958 1:171835303-171835325 TCCTTCAGTTCTTTCTCCAAAGG - Intergenic
917155899 1:171998762-171998784 TGCTTAAATGCTGCCTCCTTAGG - Intronic
918422856 1:184381622-184381644 TTCTTCTTGGCTTTCTCCTTAGG - Intergenic
918948951 1:191109710-191109732 TGCTTCAGTGCATACACCATTGG - Intergenic
919505608 1:198394361-198394383 TGCCTCAGTGCTTCCTCATGTGG - Intergenic
920679220 1:208060039-208060061 TGCTCCCCCGCTTTCTCCTTTGG + Intronic
920908221 1:210190817-210190839 TGGTTGGGTACTTTCTCCTTTGG + Intergenic
921462009 1:215439498-215439520 TGATTCAGTGCTTTTTTTTTTGG + Intergenic
922075660 1:222241406-222241428 TGCTTAAGTGCTTTTTACTTGGG + Intergenic
922406302 1:225316653-225316675 TGCTTCAGTTCTCCCTCCATGGG + Intronic
922653308 1:227359385-227359407 TTCTTCAGTGCTTCTTCCATGGG + Intergenic
924332514 1:242954231-242954253 TGCTCCAGTGCTTTCTGGTGAGG + Intergenic
1062927884 10:1330643-1330665 TACTTCTGTGCTTTCTTCTAAGG - Intronic
1064453872 10:15468812-15468834 TGTCTCACTGCTTTCTCCTTAGG + Intergenic
1064598501 10:16970143-16970165 TCCTTCATTACTTTCCCCTTCGG - Intronic
1065159036 10:22900161-22900183 TGCTTCAGAGTTTTGTCTTTTGG + Intergenic
1065828038 10:29589521-29589543 TGCTTCAGTGCCATCTAATTTGG - Intronic
1065974326 10:30829249-30829271 TGCTCCAGTGCCTTCTCCAGGGG - Intronic
1066604458 10:37146737-37146759 TGCTTAAGTGCTTTTTACTCAGG - Intronic
1067096063 10:43300947-43300969 TGCTTAATTGCTTTCTACTTGGG - Intergenic
1067096740 10:43306365-43306387 TGCTTAATTGCTTTCTACTTGGG - Intergenic
1067826730 10:49579505-49579527 CTCTTCAGTGCTCTCTTCTTTGG - Intergenic
1068327482 10:55512792-55512814 TCCTTCTGTTCTTTCTGCTTTGG - Intronic
1068910771 10:62375806-62375828 TGCTTCAGTGTTCTCTTCTGTGG + Intronic
1070154052 10:73822699-73822721 AGCTTCAGTTCCTTCTGCTTAGG + Intronic
1070484805 10:76919885-76919907 TTCTTCAGTTCTTTATCCATAGG - Intronic
1071079747 10:81796656-81796678 TGCTTCTGTTATCTCTCCTTTGG - Intergenic
1071163510 10:82778934-82778956 TGCTGCAGCTCCTTCTCCTTGGG - Intronic
1073074141 10:100812848-100812870 TGCATCTGGGCTCTCTCCTTCGG - Intronic
1073377660 10:103050729-103050751 TGCTTCTCTGCTTTCTCTTTGGG + Intronic
1073679488 10:105687015-105687037 TGCTTCAGCTTTGTCTCCTTGGG - Intergenic
1073823502 10:107292109-107292131 GGCTTAAATGCTTTCTCCGTGGG + Intergenic
1073870807 10:107862080-107862102 TGATTCAATTCTTTCTCATTAGG + Intergenic
1074616514 10:115074368-115074390 TGCTAAAGTGCTTGCTTCTTAGG - Intergenic
1074637647 10:115339159-115339181 TCCTTCAGTTCTTTTTGCTTTGG + Intronic
1075304205 10:121353425-121353447 TCCTTCAGGGCATTCTTCTTAGG - Intergenic
1075741688 10:124699940-124699962 TGCTTCAGGGAGTTCTCTTTCGG + Intronic
1076003917 10:126932950-126932972 TCCTTCAGTCCTTTTTCCATAGG + Intronic
1076186118 10:128450806-128450828 TGCTTCAGTGCCTGATCCTCTGG + Intergenic
1077865941 11:6222017-6222039 TGCTTGCCTTCTTTCTCCTTTGG - Intronic
1078894884 11:15589200-15589222 AGCTTCATTACTTTCTCCATGGG + Intergenic
1080168913 11:29275025-29275047 AGCTTCAGTTTTTTCTCTTTAGG - Intergenic
1080683038 11:34493718-34493740 TCCCTCACTTCTTTCTCCTTTGG - Intronic
1081272120 11:41097551-41097573 TTCTTCAATGGTTTCTCCATAGG - Intronic
1084583285 11:70037925-70037947 CAGTTCACTGCTTTCTCCTTGGG - Intergenic
1085402791 11:76244582-76244604 TGCAGCACTGCTTTCTCCTATGG + Intergenic
1087475695 11:98631140-98631162 TGCTTAAGTGCTTTTTACTTGGG - Intergenic
1087608270 11:100404076-100404098 TGCTACACTGCTTTCATCTTAGG - Intergenic
1088619421 11:111666265-111666287 AGGTTCTGTGCTTTCTCCTGAGG + Intronic
1088779076 11:113116383-113116405 GGCTGCAGTGCTTTCTCCAAGGG + Intronic
1088973319 11:114792295-114792317 TCCATCAGAGCTGTCTCCTTGGG + Intergenic
1090133252 11:124168143-124168165 TGCTTACGTGCTTTCTACTAGGG - Intergenic
1090432571 11:126658352-126658374 TGCATCTGTGCTTTTTCTTTAGG - Intronic
1090575681 11:128100494-128100516 TGCCTCAGTCCTTTCTCTGTTGG + Intergenic
1090966986 11:131607388-131607410 TGCTTCAGTAGGTTATCCTTGGG + Intronic
1091711003 12:2740485-2740507 GGGTCCAGTGCTTTCTCCTCAGG + Intergenic
1091717046 12:2785285-2785307 TGCTTAAGTGCTTTCTACTTGGG - Intergenic
1092664650 12:10782512-10782534 TTCCTCTATGCTTTCTCCTTAGG - Intergenic
1093119194 12:15246927-15246949 TGGTTCCTTGCTTTGTCCTTTGG - Intronic
1094743943 12:33321290-33321312 GGCTTCAGTGCATTGTCCATGGG + Intergenic
1095155617 12:38850222-38850244 TGCTTTAGTGCTCTCTGCTCTGG - Intronic
1096534545 12:52262923-52262945 TGCTTAATTGCTTTCTACTCGGG - Intronic
1096709132 12:53442673-53442695 TGCCTCATTTCTTTCTCCTCAGG + Exonic
1098679350 12:73330946-73330968 TGCTCAACTGCTTTCTCCATGGG + Intergenic
1100213343 12:92421265-92421287 TGTTTCAGTGCTTTCAGCTCAGG + Intronic
1100816917 12:98395689-98395711 TGCTTCACAGCTCTCTCCCTTGG - Intergenic
1101001460 12:100362041-100362063 TGCTCCAGAGCCTTCCCCTTTGG - Intronic
1102594709 12:113983612-113983634 TGCTTCAGTGGTTCCTCCAGTGG - Intergenic
1102718982 12:115000326-115000348 AGCTTCAGTTCTGTCTTCTTGGG - Intergenic
1102847696 12:116204973-116204995 TGCTTCTTTGCTGTCTCCTCTGG + Intronic
1103130806 12:118466912-118466934 TGTTCCAGACCTTTCTCCTTGGG + Intergenic
1104153509 12:126107959-126107981 TGCTTAATTGCTTTCTACTCTGG - Intergenic
1104220786 12:126783141-126783163 TACTTCATGGGTTTCTCCTTCGG - Intergenic
1104344096 12:127980244-127980266 TGCTTAATTGCTTTCTACTCGGG + Intergenic
1105553644 13:21423736-21423758 TGCTTCATTTGTTTTTCCTTTGG + Intronic
1105830962 13:24162359-24162381 TGCCTCAGTGCCTTCTGCTGCGG + Intronic
1105885719 13:24639463-24639485 TGTTTTAGGACTTTCTCCTTAGG + Intergenic
1106053426 13:26214235-26214257 CATTTCAGTGCTGTCTCCTTGGG + Exonic
1106648624 13:31664892-31664914 TCCTTCAGTGCTGTCATCTTAGG + Intergenic
1107462834 13:40620660-40620682 CATTTCAGTGCTGTCTCCTTGGG - Intronic
1107688467 13:42927930-42927952 TTTTTCACTGCTTTCTCCTATGG - Intronic
1108971703 13:56383588-56383610 TGCTTCATTCCTATCTCCTGTGG + Intergenic
1110479734 13:75960390-75960412 TGCTTCAGAGCCTTCCCCTCTGG + Intergenic
1111124354 13:83894606-83894628 TGCTGCACTGCGTTCTCCTCTGG + Intergenic
1111485500 13:88894035-88894057 TCCTTCTGTGTTTTCTTCTTTGG - Intergenic
1112158920 13:96848521-96848543 TGCTTAAGTGCTTTCTACTCAGG - Intergenic
1112387911 13:98957248-98957270 TGTTTCAGTTCTTGCTCCTGGGG - Intronic
1112414001 13:99189430-99189452 TTCTTCAGTGCTGGCTCCTGTGG - Intergenic
1113400113 13:109984184-109984206 TCCTTCAGTGCCTTCCTCTTTGG - Intergenic
1113467430 13:110522165-110522187 TGCCTCAGTGCTTCCTCCTGGGG + Intergenic
1113544643 13:111138808-111138830 TGATGCAGTGTTTTCTCCTATGG - Intronic
1114207144 14:20582618-20582640 TGCTTTATTGCTCTGTCCTTTGG + Intergenic
1114369904 14:22075283-22075305 TGCTTCACTGCTGGCTTCTTTGG + Intergenic
1114738440 14:25068067-25068089 TCCTTCAATTGTTTCTCCTTTGG + Intergenic
1114760313 14:25307196-25307218 TCCTACAGTGCTTTCTCTTTAGG - Intergenic
1116012479 14:39367175-39367197 TGCTACAGTGCCCTATCCTTGGG + Intronic
1117013594 14:51495437-51495459 TGACTCAGTGATTTCTTCTTTGG - Intronic
1117508880 14:56428969-56428991 TGCTCCAGTGATTTCTCTATTGG + Intergenic
1118430468 14:65714355-65714377 TGGTTTTGTGCTTTCTGCTTAGG + Intronic
1118499082 14:66340580-66340602 TTCTTCTGTGATTTCTTCTTTGG - Intergenic
1118761884 14:68885150-68885172 TGGTTCTGAGCTTTCTCGTTGGG - Intronic
1118790770 14:69090370-69090392 GGCCTCAGTGATGTCTCCTTGGG - Intronic
1119605809 14:76015362-76015384 TGCTTCAGTGCTCTCTCCTGAGG + Intronic
1119708598 14:76804346-76804368 TGCTTTGGTGCTTTCCCATTTGG - Intronic
1121022248 14:90587390-90587412 TGCTTTACTGCTTACTCCTCAGG + Intronic
1121832068 14:97061179-97061201 AGCTTCACTGATCTCTCCTTAGG - Intergenic
1121933906 14:97998901-97998923 TGCTACAGGGCTTTCTTCCTTGG - Intergenic
1123192197 14:106581962-106581984 TGTTTCTGTGCCTTCTCCCTTGG - Intergenic
1126091175 15:45053450-45053472 TGCTTCAGCTTTGTCTCCTTAGG - Intronic
1128135334 15:65259105-65259127 TGCAGCAGGGCTTTTTCCTTTGG + Exonic
1129801193 15:78415812-78415834 TGCCTCAGTGCTTTTTCATTTGG + Intergenic
1131212998 15:90513684-90513706 TGCTTAATTGCTTTCTACTCAGG - Intergenic
1131825285 15:96317062-96317084 TGTTTCAATGATTTCTCTTTAGG - Intergenic
1132540959 16:509560-509582 TGGTTCAGTCCTGTCTCCTGCGG + Intronic
1135290673 16:21235231-21235253 AGCTTAAATGCTTTCCCCTTAGG - Intronic
1135647065 16:24172374-24172396 TAGTGCTGTGCTTTCTCCTTGGG + Intronic
1137061835 16:35797987-35798009 TGCTTAATTGCTTTCTACTCAGG + Intergenic
1140761694 16:78114949-78114971 GGGTTCACTGCTTTCTCTTTTGG + Intronic
1140895171 16:79318270-79318292 TGCTTGAGAGCATTGTCCTTTGG + Intergenic
1141353208 16:83318006-83318028 TCCTCCAGTGGTTTTTCCTTTGG - Intronic
1142036412 16:87864821-87864843 TGTTTAAGTGCTTTTTACTTGGG - Intronic
1142364779 16:89644506-89644528 TGCCTCAGTCCTGTCCCCTTGGG - Exonic
1143397197 17:6610278-6610300 TGCCACAGTGCTTTCTACTCAGG - Intronic
1143975088 17:10823673-10823695 TGCTTCTGTTCTTTCACCTACGG + Exonic
1144217719 17:13071114-13071136 AGCTTGGGTGCTCTCTCCTTTGG - Intergenic
1145078413 17:19874376-19874398 TGCTCCAGAGCTTTCTGCTGAGG - Intergenic
1145972097 17:28962261-28962283 TCCTTCCATGCTGTCTCCTTGGG + Intronic
1146198900 17:30838329-30838351 TGCTACATTGGTATCTCCTTTGG + Intronic
1146975882 17:37111439-37111461 TGCTTCAGTGCCTCCTCCCCTGG + Intronic
1147786867 17:42984790-42984812 TTCCACAGTTCTTTCTCCTTAGG + Intronic
1148997370 17:51722899-51722921 TACTTTGGTACTTTCTCCTTTGG + Intronic
1150716234 17:67574813-67574835 CGGGTCAGTACTTTCTCCTTCGG - Intronic
1151216237 17:72578523-72578545 TTCCTCAGCGCTTCCTCCTTGGG - Intergenic
1151802245 17:76385242-76385264 TGCTCCGGGGCTTTCTCCCTGGG - Intronic
1151861113 17:76762777-76762799 TGCTTAATTGCTTTCTACTCGGG - Intronic
1151952862 17:77364757-77364779 TGCTCCAGAGCTTTCTCCAGAGG - Intronic
1153840316 18:9001473-9001495 TGCTTGGTTGCTTTCTCCTGAGG - Intergenic
1154044600 18:10892992-10893014 TGCTTCAGTGGTTTCTCCCTGGG + Intronic
1154303429 18:13214234-13214256 GGCTGCAGAGCTCTCTCCTTGGG - Intergenic
1154477823 18:14781889-14781911 TGCTTAAGTGCTTTTTACTTGGG - Intronic
1155325139 18:24657444-24657466 TGCTCAAGTGCTTTCTGCCTGGG + Intergenic
1158028070 18:52927546-52927568 TGCTTCTTTGATTTTTCCTTAGG + Intronic
1159250580 18:65870713-65870735 AGCTTCAGTGTTATCTCCTCAGG + Intronic
1162262453 19:9543944-9543966 TGCTTGGGTACTTTCACCTTTGG + Intergenic
1163172936 19:15545210-15545232 TTCTTCAGTGCCTTCTGCTCAGG - Intronic
1164092815 19:21975327-21975349 TGCTGCAGTGCATTTACCTTTGG - Intronic
1165169926 19:33884702-33884724 TGCTTCAGTGCTTACCTGTTGGG - Intergenic
1166228301 19:41410926-41410948 AGCTTCAGCACCTTCTCCTTCGG - Exonic
1166255323 19:41600348-41600370 TGCTTAATTGCTTTCTACTTGGG - Intronic
1166777556 19:45322183-45322205 TGCCTCAGTGCCCTCTCCTGGGG - Intronic
1168706333 19:58472344-58472366 TGCTGCAGTGCTACCTCTTTGGG - Exonic
925076991 2:1025138-1025160 TGCCTCAGTGTTTTCCCCTAGGG + Intronic
925159491 2:1674081-1674103 TTGTTCATTGCTTTCTCCTTTGG - Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
926189860 2:10720842-10720864 TGCTTTAAAGCCTTCTCCTTCGG + Intergenic
927048650 2:19305127-19305149 TTCCACAGTGCTTTCTGCTTTGG - Intergenic
927871463 2:26627031-26627053 TAGTCCAGTGCTTACTCCTTTGG + Intronic
928064064 2:28145443-28145465 TGCTACAGTGTATTTTCCTTTGG - Intronic
928188516 2:29138445-29138467 GGCTTCTGTTCTTTCTGCTTAGG + Intronic
929358420 2:41054056-41054078 TCCTTCAGTGCTTTCATTTTTGG + Intergenic
930314450 2:49780570-49780592 TTCTTCAGTTCAATCTCCTTAGG + Intergenic
931248186 2:60508373-60508395 GGCTGCAGTGCTTGCTCCTGTGG - Intronic
931747913 2:65307010-65307032 TGCTCCAGGCCTCTCTCCTTGGG - Intergenic
932307077 2:70711671-70711693 AGCTTCCGTGCTCTCTCCTGTGG - Intronic
933455999 2:82520087-82520109 TCCCTCATTGCTTGCTCCTTTGG + Intergenic
934180230 2:89612646-89612668 TCCTTCAGTGATTTTTCCTTTGG + Intergenic
934290522 2:91686906-91686928 TCCTTCAGTGATTTTTCCTTTGG + Intergenic
934537123 2:95143964-95143986 TGCTTAATTGCTTTCTACTTGGG + Intronic
935986790 2:108681139-108681161 ATTTTCACTGCTTTCTCCTTTGG + Intronic
936021512 2:108998526-108998548 TGATTCTGTGATCTCTCCTTAGG - Intergenic
936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG + Intergenic
936828325 2:116608741-116608763 TTTTTCAGTGCTCCCTCCTTGGG - Intergenic
936909735 2:117577764-117577786 TGCTTCATTTGTTTCTCCCTTGG - Intergenic
937789139 2:125939806-125939828 TTCTTAAGTGTTTTCTCCTTGGG + Intergenic
937789580 2:125944148-125944170 TGCCTAATTGCTTTCTACTTGGG - Intergenic
939536766 2:143441123-143441145 TGTCTCAGTGCTATCTGCTTGGG - Intronic
941417530 2:165240630-165240652 TGCCTCACTTCTTTCTCCTGTGG + Intronic
942093840 2:172519474-172519496 TGCTTAATTGCTTTCTACTCAGG + Intergenic
946661984 2:222010977-222010999 AGCTTCTGTTCTCTCTCCTTTGG - Intergenic
946858603 2:223978394-223978416 TGTGTCTGTGCCTTCTCCTTTGG + Intronic
947578816 2:231298484-231298506 TCCTTCAGAGCTGTCACCTTGGG - Intronic
948521665 2:238542908-238542930 TGGTGCAGTGCTTGCACCTTAGG + Intergenic
948625959 2:239268143-239268165 CGCTGCTGAGCTTTCTCCTTAGG + Intronic
1169667656 20:8056313-8056335 TGCTTTTGTGTTTTCTCTTTTGG - Intergenic
1169868818 20:10229999-10230021 TTCTGCAGCCCTTTCTCCTTTGG - Intronic
1172067672 20:32233293-32233315 GGCTTCAGTGGTGCCTCCTTGGG - Intronic
1172568262 20:35948146-35948168 GGCTGCCCTGCTTTCTCCTTAGG + Exonic
1172828250 20:37808666-37808688 TCCTTCCATGCATTCTCCTTGGG + Intronic
1172863579 20:38077227-38077249 TCCTTGAGTGCTTTATACTTAGG + Intronic
1173147438 20:40536935-40536957 TGCTCCAGTGGCTTCTTCTTGGG - Intergenic
1173873430 20:46355582-46355604 TCCTGCAGTGCTTTCACCTTTGG + Intronic
1173918416 20:46726291-46726313 TTTGTCAGTGCCTTCTCCTTTGG + Exonic
1174240932 20:49133911-49133933 AGCTTCAGTGCTCCATCCTTTGG - Intronic
1174581517 20:51575323-51575345 TCCTACAGTGCATACTCCTTTGG - Intergenic
1174949075 20:55023914-55023936 TGCTTCAGTTCTCTCTCAGTGGG - Intergenic
1174971651 20:55282687-55282709 GGTTTCAGTGCTATCTCCTGTGG - Intergenic
1175000699 20:55626446-55626468 AGCCTGGGTGCTTTCTCCTTTGG - Intergenic
1175645622 20:60668391-60668413 TTCTTCAGTGCGTTCTGCCTTGG - Intergenic
1177062840 21:16395722-16395744 TGGTTAAGTACTTTCACCTTTGG - Intergenic
1177902161 21:26930099-26930121 TGCATCAGTATTTGCTCCTTTGG + Intronic
1178110254 21:29363113-29363135 TCCTTCTGTGCTTTCTCTTCTGG + Intronic
1179103120 21:38374422-38374444 TGCTTAATTGCTTTCTACTCGGG - Intergenic
1179178956 21:39029060-39029082 TGCTTCAGAGCTTTGACTTTAGG + Intergenic
1179557886 21:42192251-42192273 TGCTTCACTGCTTTGCCCTGAGG - Intergenic
1181326047 22:22046993-22047015 TTCTGCAGTGCTGTCTCCCTAGG - Intergenic
1181810946 22:25403714-25403736 AGCTGTAGTTCTTTCTCCTTAGG + Intronic
1183592470 22:38787965-38787987 ACCTTCTGTGCTTTCTCCTTTGG + Intronic
1184576103 22:45367585-45367607 TGCTTCACTGCTTTGTCTGTCGG + Intronic
949819028 3:8094951-8094973 GCTTTCAGTGATTTCTCCTTTGG - Intergenic
949850460 3:8415334-8415356 TGGTTCAGTGATCTTTCCTTAGG + Intergenic
950860526 3:16144036-16144058 TGCTTAATTGCTTTCTACTTGGG - Intergenic
951688713 3:25373117-25373139 TGCTTGACTGTTTTCTCCCTTGG - Intronic
952443702 3:33359632-33359654 TGGTTCAGTGCTTTAACCTTAGG + Intronic
955400782 3:58589978-58590000 GGCTTCAGGGCTTGGTCCTTAGG + Intronic
960142319 3:114163014-114163036 AGCTTGAGGGCTTTGTCCTTTGG - Intronic
960305976 3:116061356-116061378 TGCTTAGGTTCTTTCTCCTTAGG + Intronic
960752400 3:120970629-120970651 TGCCTTAGAGATTTCTCCTTTGG + Intronic
962007751 3:131364171-131364193 TCCTTCAGAGCTTTCATCTTTGG + Intergenic
963312346 3:143722528-143722550 TGGTACAGTGACTTCTCCTTAGG - Intronic
963951279 3:151204935-151204957 CACTTCAGTGCTTTCACATTTGG - Intronic
964261453 3:154842776-154842798 TGCTTCAGTGCGTTAGCCCTTGG + Intergenic
964507657 3:157417250-157417272 GTCTTCAGTGCTTCCTCATTGGG + Intronic
964530663 3:157664219-157664241 CCATTCAGTGCTTTCTCCCTAGG - Intronic
964730078 3:159855913-159855935 TGCTTCTGTTCTTTTTCCGTGGG + Intronic
964971560 3:162569446-162569468 TGCTTAATTGCTTTCTACTGGGG - Intergenic
966167405 3:177035963-177035985 TGCTTAAGTGCTTTTTACTTGGG - Intronic
967581381 3:191159750-191159772 TGCTTCAGAGTTTGCTTCTTAGG - Intergenic
968428408 4:537879-537901 TGCTTCAGTGCTCACTGCTCAGG - Intronic
969981900 4:11166046-11166068 TACTTCAGTGCTTTGTTCTCTGG - Intergenic
970588407 4:17536708-17536730 TGCTTTATTGCTTTCTGTTTTGG + Intergenic
970777204 4:19689424-19689446 ATCTTCAGTGTTTTCTGCTTTGG - Intergenic
973541811 4:51942344-51942366 TGCTTCATTTCTTTTTCCTGGGG - Intergenic
973629798 4:52809876-52809898 TGCTTCAGTGTAATCTCCATGGG - Intergenic
974931770 4:68367984-68368006 TGCTTAATTGCTTTCTACTCGGG + Intergenic
975423773 4:74202230-74202252 TGCTTAATTGCTTTCTACTTGGG - Intronic
975989832 4:80247236-80247258 TACTTCAGGGCTTTCTCCTAAGG + Intergenic
976409251 4:84694270-84694292 TGGCGCAGTGCTCTCTCCTTAGG - Intronic
977628811 4:99218727-99218749 TTCTCCAGTGATTTCCCCTTCGG + Intronic
978667848 4:111207701-111207723 TGCTACAGTGCTCTCTCAATCGG - Intergenic
978944530 4:114479740-114479762 TGCTTAAGTGCTTTTTACTCGGG + Intergenic
979359023 4:119740067-119740089 TGCTTCTGAGCTTTTTACTTTGG - Intergenic
979904090 4:126262619-126262641 TTCTTCACTGATTTCTCTTTTGG + Intergenic
984268711 4:177524882-177524904 TTCTTAATTGCTTTCTACTTGGG + Intergenic
984606869 4:181795913-181795935 TGCTTCTGTGCTTTGCCCATTGG - Intergenic
984644374 4:182203716-182203738 TGCTACAGTTCTTGCTCCATTGG + Intronic
985066698 4:186129323-186129345 TGCATCCTTGCTCTCTCCTTTGG - Intronic
985771313 5:1813438-1813460 CTGTTCAGTGCTTTCTCCTTTGG + Intronic
986146227 5:5080333-5080355 TGCTTCAGTATTTTCCACTTTGG + Intergenic
987294767 5:16540027-16540049 TTCTTGAGTGCTTTCTGGTTAGG + Intronic
987480204 5:18445952-18445974 TGATTCCCTGTTTTCTCCTTTGG + Intergenic
987577157 5:19744721-19744743 GGCTTCAGTGTTTTCTCTGTAGG + Intronic
988005167 5:25401335-25401357 TGCTTAATTGCTTTCTACTCCGG + Intergenic
988234325 5:28521247-28521269 TGCTTAATTGCTTTCTACTCGGG - Intergenic
989495683 5:42109323-42109345 TGCTTAATTGCTTTCTACTCGGG + Intergenic
991960662 5:72040741-72040763 TCCTTCAGTGCTTGCTTCTCTGG - Intergenic
993898420 5:93567561-93567583 TGTTTCATTGATTTCTCTTTAGG - Intergenic
994040409 5:95252895-95252917 TGCTACAGTGCTTAATCCTTGGG - Intronic
994287221 5:97983629-97983651 TGCATAAGTGCTTTTTCATTTGG + Intergenic
994525674 5:100902572-100902594 TTCTGCAGTGACTTCTCCTTTGG + Intronic
995508574 5:112885222-112885244 CTCCTCAGTGCCTTCTCCTTGGG - Intronic
996253589 5:121369785-121369807 TGCTTAAGTGCTTTTTACTTGGG - Intergenic
996703392 5:126472280-126472302 TGCTTCAGTGGTTCCTCCGTTGG - Exonic
998028765 5:138845049-138845071 TGATTCAGTCCTGGCTCCTTCGG - Intronic
998056526 5:139082967-139082989 TGCTTCAGTGCTTTTTGAGTTGG - Intronic
998371332 5:141663598-141663620 TTCTTCAGGGCTTTCTCACTGGG + Intronic
998677789 5:144429065-144429087 TTCTTTATTGTTTTCTCCTTTGG - Intronic
998942985 5:147305122-147305144 TGTTGCAGAACTTTCTCCTTAGG + Intronic
999344944 5:150809458-150809480 TGCTTAATTGCTTTCTACTTGGG + Intergenic
1000331667 5:160210649-160210671 TGCTCCTGTGTTTTCTCCCTGGG - Intronic
1000613548 5:163402061-163402083 TGCTTCAGTTTTTTCTGGTTTGG + Intergenic
1001072594 5:168599892-168599914 CGCCTCAGTGATTTTTCCTTAGG + Intergenic
1002200760 5:177526600-177526622 TGTTTCTGTGCTTTCTCCTCTGG - Intronic
1003414576 6:5896530-5896552 TGTTCCAGGGCTTTCTCCCTAGG - Intergenic
1003437551 6:6105944-6105966 TGCTTTACTCCTTTCTCCATGGG + Intergenic
1003604492 6:7546958-7546980 TGCCTCAGTGCTGACTTCTTAGG + Intronic
1004575836 6:16893365-16893387 TTCTTTAGTGTTTTTTCCTTTGG + Intergenic
1004576278 6:16898380-16898402 TGCATCAGACATTTCTCCTTTGG + Intergenic
1004795168 6:19074285-19074307 TGCTTCTGTCTTTTCTTCTTTGG + Intergenic
1005809106 6:29502740-29502762 TGCTTCCGCACTATCTCCTTGGG + Intergenic
1005953774 6:30649536-30649558 CCCTTCTGTTCTTTCTCCTTAGG + Exonic
1006310964 6:33259211-33259233 TGCTTAACTGCTTTCTACTCAGG - Intronic
1007019100 6:38501433-38501455 ATCTTCAGTGCTTTCCACTTGGG + Intronic
1007292618 6:40798800-40798822 TACTTCACTGCTTTCCCCTGGGG - Intergenic
1007501693 6:42303402-42303424 TGCTTCAGTAATTTATTCTTAGG - Intronic
1007806701 6:44455642-44455664 TGCTTCAGGGATTACACCTTGGG + Intergenic
1008828209 6:55725490-55725512 TGCTTCAGTGCATTCTATTTTGG - Intergenic
1009611521 6:65947766-65947788 TACCTCAGTTCTTTCTACTTAGG + Intergenic
1010075637 6:71793940-71793962 TGCTTAAGTGCTTTTTACTTGGG - Intergenic
1010235211 6:73569456-73569478 TGGTTAAGTGCTTCCTCTTTGGG + Intergenic
1010270565 6:73911766-73911788 TGCTTAATTGCTTTCTACTCAGG - Intergenic
1010567502 6:77433800-77433822 TTCTTCTGAACTTTCTCCTTTGG - Intergenic
1010773529 6:79859812-79859834 GACTTCAGTGTTTTCTCCTAAGG - Intergenic
1011381433 6:86746116-86746138 TGATTCAGGGCTTTATCCTGAGG - Intergenic
1013608087 6:111769124-111769146 CCCTTCAGTGCTGTATCCTTTGG - Intronic
1014216363 6:118755995-118756017 TGCTTGAGTGCTTTTTCCACAGG - Intergenic
1014331113 6:120064607-120064629 TCCTTGAGTGCTGTTTCCTTTGG + Intergenic
1014450640 6:121577599-121577621 TACTTCAGTGCATTCCCCCTAGG + Intergenic
1014933091 6:127356746-127356768 TGCTTCAGCTTTGTCTCCTTGGG - Intergenic
1015309753 6:131753722-131753744 TGGTTCAGTGTTTTTTCCTCAGG + Intergenic
1015917776 6:138235066-138235088 TACTTTAGTGATTTCTCCCTGGG + Intronic
1016690324 6:146930446-146930468 TGCTGCAGCTCTCTCTCCTTTGG - Intergenic
1016944927 6:149522206-149522228 ATCTTCAGAGCTTTCTCTTTGGG - Intronic
1017868747 6:158468197-158468219 TGCTTAAGTGCTTTTTACTGGGG - Intronic
1018254299 6:161903154-161903176 TGCTTCCGTCCTGTCTCCTTTGG - Intronic
1018282764 6:162205891-162205913 TTCTTCTGTGCTTTCTAGTTTGG - Intronic
1020749245 7:12119324-12119346 TGGATCACTGTTTTCTCCTTAGG - Intergenic
1020784822 7:12560702-12560724 TCCTTCTTTGTTTTCTCCTTAGG - Intergenic
1020792190 7:12641067-12641089 TGGCTAAGTGCTTTCACCTTAGG + Intronic
1020805596 7:12786483-12786505 TGCTTCAGTTCTCTCACTTTTGG + Intergenic
1021660218 7:22912630-22912652 TGCTTCAGAGATTTTTCCTATGG + Intergenic
1022601837 7:31768171-31768193 TGCATGACTGCTTTCTACTTGGG + Intronic
1023062796 7:36344559-36344581 TGGTTAAGTGCCTTCTACTTTGG + Intronic
1023136102 7:37053749-37053771 TGCTTAAGTCCTTTCTCCTCGGG + Intronic
1023898317 7:44453469-44453491 TGATTTAGTGCTTTCTCCTTTGG - Intronic
1024584269 7:50827470-50827492 TGCATCAGTCCTTCCTCCTGTGG - Intergenic
1025625721 7:63219482-63219504 TTCTACCCTGCTTTCTCCTTTGG - Intergenic
1025656399 7:63523691-63523713 TTCTACCCTGCTTTCTCCTTTGG + Intergenic
1032894413 7:136234892-136234914 TGCTTCAGTTCTTTTTTCATTGG - Intergenic
1032913430 7:136460238-136460260 TGCTTAAGTGATTTGTTCTTCGG + Intergenic
1032974159 7:137202606-137202628 TTGTTCAGTGCTTTATCCTCAGG + Intergenic
1034384978 7:150733413-150733435 CACCTCAGGGCTTTCTCCTTGGG + Intronic
1034724377 7:153321817-153321839 TGCTTCAGAGCATTCTCGCTGGG - Intergenic
1036101227 8:5787950-5787972 TGCTTCACTGCTTTCTGGTAGGG - Intergenic
1037015873 8:13905488-13905510 TCCTTCAATTCTTTCTCATTAGG + Intergenic
1037211542 8:16394169-16394191 TGCTTCAGTGTTCTGTCTTTGGG + Intronic
1038535169 8:28348612-28348634 TGTTTCCGTTCTTTCTCTTTCGG + Exonic
1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG + Intergenic
1040037657 8:42886256-42886278 TGCTGCAGGGCTCTGTCCTTGGG - Intronic
1040786321 8:51168545-51168567 TGCCTCAGTGCCTACTCCTCAGG + Intergenic
1040918228 8:52586016-52586038 TGCTTCAGGCCCTCCTCCTTAGG - Intergenic
1041662471 8:60413307-60413329 TCCCTCAGCGCTTTCTGCTTGGG - Intergenic
1042853572 8:73240931-73240953 TGCTTCAGTTCATCCTCCATGGG + Intergenic
1043473551 8:80584278-80584300 TTCTTCTTTTCTTTCTCCTTTGG - Intergenic
1044134564 8:88570341-88570363 CGCTTCAGTGCTTTGACCTCAGG - Intergenic
1044911628 8:97065950-97065972 TGCTTCAGTGCTTTCTCCTTGGG - Intronic
1046558302 8:115804766-115804788 TGTTTAAGTGCTTTCTCTTTAGG + Intronic
1046896684 8:119480686-119480708 TGGTTGAGTGATTGCTCCTTGGG + Intergenic
1047631479 8:126713453-126713475 TTCCTCAGAGCTCTCTCCTTTGG + Intergenic
1048382334 8:133877594-133877616 TTCTTCCCTGCTTTCTCCTGTGG + Intergenic
1048489766 8:134881747-134881769 CACTTCAGTGCCTTCTCCCTAGG - Intergenic
1048874555 8:138826921-138826943 GCCTTCACTGCCTTCTCCTTAGG + Intronic
1049762462 8:144337426-144337448 TGCCTCAGCACTTGCTCCTTCGG - Intergenic
1050493475 9:6214620-6214642 TGCTTCACTGCTTTATCCAAAGG + Intergenic
1050576777 9:7005090-7005112 TGCTTAATTGCTTTCTACTCAGG - Intronic
1050626127 9:7505412-7505434 TGCTTCAGTGCTTTTCCCCAGGG - Intergenic
1050672324 9:8011339-8011361 GGCTTAAATGCTTTCTTCTTAGG - Intergenic
1052004037 9:23324663-23324685 TGCTTAAGTGCCTTTTACTTGGG + Intergenic
1052969813 9:34370615-34370637 TGCTTCAGTGCCCCCTCCCTAGG + Exonic
1052987890 9:34501556-34501578 TCCTTCAGTGGTTTCCCCTCAGG - Intronic
1053153928 9:35760944-35760966 TGCTGGCTTGCTTTCTCCTTAGG + Intergenic
1053602664 9:39626398-39626420 TGCTTAATTGCTTTCTACTCAGG + Intergenic
1053860311 9:42380146-42380168 TGCTTAATTGCTTTCTACTCAGG + Intergenic
1054250874 9:62716037-62716059 TGCTTAATTGCTTTCTACTCAGG - Intergenic
1054564979 9:66750550-66750572 TGCTTAATTGCTTTCTACTCAGG - Intergenic
1054728710 9:68678639-68678661 TGCTGCTGTGATTTCTCCTTGGG + Intergenic
1055239905 9:74171129-74171151 TGACTCTGTGCTTTCTTCTTTGG + Intergenic
1056703041 9:88926445-88926467 TGCCTCAGTCCTGTCTCCTGGGG + Intergenic
1057155421 9:92833955-92833977 TGCTTAATTGCTTTCTACTCAGG + Intergenic
1057357374 9:94342898-94342920 TTCTTAAGTGCTTCCTCCTCTGG - Intergenic
1057650378 9:96914728-96914750 TTCTTAAGTGCTTCCTCCTCTGG + Intronic
1059071175 9:111137861-111137883 TGCTTCAGTCCTTTCTATTGTGG - Intergenic
1059776515 9:117481248-117481270 TGCTTCTGCCATTTCTCCTTGGG - Intergenic
1060185701 9:121562879-121562901 TGGTTGAGGTCTTTCTCCTTAGG + Intergenic
1061199877 9:129131673-129131695 AGCTTCACTGCTTTCTGTTTTGG + Intronic
1062052100 9:134452910-134452932 TGCTCCAGTGCTGCCTCCTCTGG - Intergenic
1185699294 X:2218278-2218300 TGCTTCATTGCTTTCTACTTAGG + Intergenic
1188629346 X:32332977-32332999 TGCCTCAGTGCTCAGTCCTTGGG - Intronic
1189057277 X:37711369-37711391 TGCCTCAGGTCTTTCTCCTCTGG + Intronic
1190556674 X:51642518-51642540 TGCCTCAGAGCTTTCACCTCTGG - Intergenic
1191951103 X:66594047-66594069 TTCCTCCGTCCTTTCTCCTTTGG + Intergenic
1192166963 X:68832501-68832523 TGCTTAATTGCTTCCTTCTTGGG + Intronic
1192698321 X:73442479-73442501 TTCTTCACGGCTTTGTCCTTTGG + Intergenic
1193096275 X:77552817-77552839 TGCTTCATCACTTCCTCCTTAGG - Intronic
1193742301 X:85232100-85232122 TGGCTCAGTGCTCTCTCCTAAGG - Intergenic
1194261638 X:91702902-91702924 TGCTTCAGCTCTTTCTCCGTGGG - Intergenic
1194756500 X:97744875-97744897 TGCTTGAGTTCTTTCTGATTTGG - Intergenic
1195768235 X:108319428-108319450 TGCTTCAGTGCTTAATTCTAGGG - Intronic
1195956321 X:110334853-110334875 TGCTTCATTGCCAGCTCCTTGGG + Intronic
1196167515 X:112551738-112551760 TGCTTCAGTTCTCCCTCCGTGGG + Intergenic
1196644865 X:118107011-118107033 TGCTTCAGTATTTTCTTCTTTGG + Intronic
1196654086 X:118198860-118198882 TGTTTCAGGCCTCTCTCCTTTGG - Intergenic
1196978234 X:121183489-121183511 TGCTTAATTGCTTTCTACTCAGG + Intergenic
1197699763 X:129590233-129590255 TCCTTCTGGGCTTTCTGCTTGGG + Exonic
1197976637 X:132172567-132172589 TGCTTCAGTGGTCTCTGCTAGGG - Intergenic
1198299582 X:135321991-135322013 TGCTTAATTGCTTTCTACTCGGG + Intronic
1199343334 X:146708394-146708416 TGCTTAAGTGCTTTTTACTTGGG - Intergenic
1199411787 X:147532489-147532511 TTCTACAGTGCTTTCTATTTTGG + Intergenic
1200580286 Y:4941695-4941717 TGCTTCAGCTCTTTCTCCGTGGG - Intergenic
1200976401 Y:9216271-9216293 TGCTTAATTCCTTTCTACTTGGG - Intergenic
1201229838 Y:11853485-11853507 TGCTCCAGTGCTTTCTGGTGAGG + Intergenic
1201273746 Y:12280287-12280309 TGCTTAAGTGCTTTTTACTTTGG + Intergenic
1201707062 Y:16949442-16949464 TGCTTCAGTTCACTCTCCTTGGG - Intergenic
1201977485 Y:19868741-19868763 TGCTTAATTGCTTTCTACTGGGG + Intergenic
1201978033 Y:19873379-19873401 TGCTTAATTGCTTTCTACTTGGG + Intergenic
1202134767 Y:21650260-21650282 TGCTTAATTCCTTTCTACTTGGG + Intergenic
1202333928 Y:23785751-23785773 TGCTTAAGTGCTTTCCACTCGGG - Intergenic
1202536840 Y:25884308-25884330 TGCTTAAGTGCTTTCCACTCGGG + Intergenic